28Sa-CARPLAT

Reference: 
Cryan_et_al_2001
Marker name: 
28S_rDNA
Direction: 
NA
Genome: 
Nucleus
Specificity: 
Platynini_(Carabidae)
project name: 
NA
Owner: 
Frederik_Hendrickx
Position on sequence: 
NA
Comment: 
nuclear
Sequence: 
GACCCGTCTTGAAACACGGA

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith