28SB

Reference: 
Whiting_et_al_1997
Marker name: 
28S
Direction: 
NA
Genome: 
Nucleus
Specificity: 
NA
project name: 
Oonopidae
Owner: 
EVA
Position on sequence: 
NA
Comment: 
NA
Sequence: 
TCGGAAGGAACCAGCTACTA

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith