28S_D2F

Reference: 
Schmidt_et_al_2006
Marker name: 
28S_rDNA
Direction: 
Forward
Genome: 
Nucleus
Specificity: 
sawflies
project name: 
ECES_PSEU
Owner: 
JEMU
Position on sequence: 
NA
Comment: 
NA
Sequence: 
CGTGTTGCTTGATAGTGCAGC

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith