Primer database

Direction Genome Marker name Owner Sequence Specificity project name
1482-R Reverse Nucleus 18S JEMU_RBINS AGGGCATCACAGACCTGTTA Holothuroidea MolChaRE
421-F Forward Nucleus 18S JEMU_RBINS AAACGGCTACCACATCCAAG Holothuroidea MolChaRE
1082R Reverse Nucleus 18S JEMU_RBINS TGATCCATCTGCAGGTTCACCT Holothuroidea MolChaRE
EC-2F Forward Nucleus 18S JEMU_RBINS AYCTGGTTGATYYTGCCAG Holothuroidea MolChaRE
606F Reverse Nucleus ITS JEMU_RBINS GTCGATGAAGAGCGCAGCCA Clitellata (annelids) SideHaplotaxis
Clone of 1082R Reverse Nucleus ITS JEMU_RBINS TTAGTTTCTTTTCCTCCGCTT Clitellata (annelids) SideHaplotaxis
1084R Reverse Nucleus ITS JEMU_RBINS YGTTAGTTTCTTTTCCTCCGCTT Clitellata (annelids) SideHaplotaxis
29F Forward Nucleus ITS JEMU_RBINS AAAGTCGTAACAAGGTTTCCGTA Clitellata (annelids) SideHaplotaxis
16Sb Forward Mitochondrion 16S JEMU_RBINS CTCCGGTTTGAACTCAGATCA Mantis ManTiS
18Sa0.7 Forward Nucleus 18S JEMU_RBINS ATTAAAGTTGTTGCGGTT Mantis ManTiS
18Sb0.5 Reverse Nucleus 18S JEMU_RBINS GTTTCAGCTTTGCAACCAT Mantis ManTiS
18Sb5.0 Reverse Nucleus 18S JEMU_RBINS TAACCGCAACAACTTTAAT Mantis ManTiS
28S_stena_F1_A Forward Nucleus 28S JEMU_RBINS GAGTTCAAGAGAACGTGAAACTACCA Isopoda/Stenasellidae SideIsopodaPM
28S_stena_R1 Reverse Nucleus 28S JEMU_RBINS CCTATACCCAGCTCTGACGATCG Isopoda/Stenasellidae SideIsopodaPM
COI_stena_F1 Forward Mitochondrion COI JEMU_RBINS TTAAGWATATTAATTCGTTCWGARYTAGG Isopoda/Stenasellidae SideIsopodaPM
COI_StenaR508 Reverse Mitochondrion COI JEMU_RBINS AAAGCTGTTAAGAATGCAGACCAGAC Isopoda/Stenasellidae SideIsopodaPM
COI_StenaR719 Reverse Mitochondrion COI JEMU_RBINS TTTATTAGACTCTTGACTAACGATATGAG Isopoda/Stenasellidae SideIsopodaPM
gib47710 Reverse Nucleus dsx-like JEMU_RBINS TGAATGCAGACGGCTTCGGATTAG Oedothorax gibbosus Ogibbosus
gib48022 Forward Nucleus dsx-like JEMU_RBINS AAGTATGGTCAAGGGCCACAAGAG Oedothorax gibbosus Ogibbosus
gib48536 Reverse Nucleus dsx-like JEMU_RBINS TGGGTTCGCTTTGGCATTTG Oedothorax gibbosus Ogibbosus
gib48920 Forward Nucleus dsx-like JEMU_RBINS GGAGAACGGACCCCTTCTTG Oedothorax gibbosus Ogibbosus
gib53269 Reverse Nucleus dsx-like JEMU_RBINS TCGACCTCATCTGTTTGGATCCCT Oedothorax gibbosus Ogibbosus
gib53424 Reverse Nucleus dsx-like JEMU_RBINS GGGCACTTCTTGTACGGACA Oedothorax gibbosus Ogibbosus
gib53531 Forward Nucleus dsx-like JEMU_RBINS TACCAGAAGTCATCCCAGGCGATA Oedothorax gibbosus Ogibbosus
gib53700 Forward Nucleus dsx-like JEMU_RBINS GACAGCTGAGAACCCCCAAG Oedothorax gibbosus Ogibbosus
HCO2198-JJ Reverse Mitochondrion COI JEMU_RBINS AWACTTCVGGRTGVCCAAARAATCA Isopoda/Stenasellidae SideIsopodaPM
LCO1490-JJ Forward Mitochondrion COI JEMU_RBINS CHACWAAYCATAAAGATATYGG Isopoda/Stenasellidae SideIsopodaPM
Niph15 Forward Nucleus 28S JEMU_RBINS CAAGTACCGTGAGGGAAAGTT Isopoda/Stenasellidae SideIsopodaPM
Niph16 Reverse Nucleus 28S JEMU_RBINS AGGGAAACTTCGGAGGGAACC Isopoda/Stenasellidae SideIsopodaPM
Niph20 Forward Nucleus 28S JEMU_RBINS AAACACGGGCCAAGGAGTAT Isopoda/Stenasellidae SideIsopodaPM
Niph21 Reverse Nucleus 28S JEMU_RBINS TATACTCCTTGGCCCGTGTT Isopoda/Stenasellidae SideIsopodaPM
Poly_ND4_R1 Reverse Mitochondrion ND4 JEMU_RBINS WMACMCCACAAATCAKWAT Mantis ManTiS
12SE1 Mitochondrion 12S Patrick Martin AAAACATGGATTAGATACCCRYCTAT
12SH Mitochondrion 12S Patrick Martin ACCTACTTTGTTACGACTTATCT
16SAR-L-F Mitochondrion 16S Patrick Martin CGCCTGTTTATCAAAAACAT
16Sbr-H Mitochondrion 16S Patrick Martin CCGGTCTGAACTCAGATCACGT
COI-3F Forward Mitochondrion COI JEMU_RBINS GAACCGGATGAACCGTCTAC Walrus Odobenus rosmarus DNADD
COI-3R Reverse Mitochondrion COI JEMU_RBINS CCGCTGTAATTAATACGGACCA Walrus Odobenus rosmarus DNADD
CR-1F Forward Mitochondrion CR JEMU_RBINS GCCTATTGCCGGTATAATCG Walrus Odobenus rosmarus DNADD
CR-2F Forward Mitochondrion CR JEMU_RBINS CTGACGCCCTACCATTCATA Walrus Odobenus rosmarus DNADD
CR-3F Forward Mitochondrion CR JEMU_RBINS AATTCACTTGGTCCGTCAAGC Walrus Odobenus rosmarus DNADD
CR-4F Forward Mitochondrion CR JEMU_RBINS TGGGACATCTCGATGGACTT Walrus Odobenus rosmarus DNADD
DL-1R Reverse Mitochondrion CR JEMU_RBINS TGTGATGGTACAGTAGGGGTGA Walrus Odobenus rosmarus DNADD
DL-2R Reverse Mitochondrion CR JEMU_RBINS AAGGGTTGCTGGTTTCTCG Walrus Odobenus rosmarus DNADD
DL-3R Reverse Mitochondrion CR JEMU_RBINS TTATGTGTGATCATGGGCTGA Walrus Odobenus rosmarus DNADD
DL-4R Reverse Mitochondrion CR JEMU_RBINS CGTGTATGTCCTGTGACCATT Walrus Odobenus rosmarus DNADD
Ele-cytB-F1 Forward Mitochondrion Cytb JEMU_RBINS TGTGGGGGTTTCTATACTGGA Loxodonta & Elephas DNADD
Ele-cytB-R1 Reverse Mitochondrion Cytb JEMU_RBINS GGGCGATTTTAGGTGAGATG Loxodonta & Elephas DNADD
Fallow2R Reverse Mitochondrion CR JEMU_RBINS GATCCTTGTCTAGCGGGT Cervidae DNADD
HCO2198 Mitochondrion COI Patrick Martin TAAACTTCAGGGTGACCAAAAAATCA universal
LCO1490 Mitochondrion COI Patrick Martin GGTCAACAAATCATAAAGATATTGG universal
Pex1F Forward Mitochondrion CR JEMU_RBINS TAAACTATTCCCTGATACTC Alopex lagopus DNADD
Pex1R Reverse Mitochondrion CR JEMU_RBINS TTAAGCATAGTATGTCTTATG Alopex lagopus DNADD
Pex2bF Forward Mitochondrion CR JEMU_RBINS ATGCCCCATGCATATAAGC Alopex lagopus DNADD
Pex2bR Reverse Mitochondrion CR JEMU_RBINS TTGATGGTTTCTCGAGGC Alopex lagopus DNADD
Pex2F Forward Mitochondrion CR JEMU_RBINS CCATGCATATAAGCATGTAC Alopex lagopus DNADD
Pex2R Reverse Mitochondrion CR JEMU_RBINS GATGGTTTCTCGAGGCATG Alopex lagopus DNADD
Ele-ND5-F3 Forward Mitochondrion ND5 JEMU_RBINS TCCTCACGTACATACTCAAAACC Loxodonta & Elephas DNADD
28SC1’-F Forward Nucleus 28S JEMU_RBINS ACCCGCTGAATTTAAGCAT Annelida Cryoli
4fb-F Forward Nucleus 18S JEMU_RBINS CCAGCAGCCGCGGTAATTCCAG Annelida Cryoli
4fbk-R Reverse Nucleus 18S JEMU_RBINS CTGGAATTACCGCGGCTGCTGG Annelida Cryoli
BGN-s1R2 Reverse Nucleus JEMU_RBINS ACGCACGGGAAGACACAG Loxodonta & Elephas DNADD
COIceR (aliquot 100 µM) Reverse Mitochondrion COI JEMU_RBINS TCGTGTGTCTACGTCCATTCCTACTGTRAACATRTG Echinodermata MolChaRE
COIeF (aliquot 100 µM) Forward Mitochondrion COI JEMU_RBINS ATAATGATAGGAGGRTTTGG Echinodermata MolChaRE
EchinoF1 (aliquot 100 µM) Forward Mitochondrion COI JEMU_RBINS TTTCAACTAATCATAAGGACATTGG Echinodermata MolChaRE
EchinoR1 (aliquot 100 µM) Reverse Mitochondrion COI JEMU_RBINS CTTCAGGGTGTCCAAAAAATCA Echinodermata MolChaRE
Ele-COL6A3-F1 Forward Mitochondrion cytb-CR JEMU_RBINS GACTTTGTCCGCAACAACCT Loxodonta & Elephas DNADD
Ele-COL6A3-R1 Reverse Mitochondrion cytb-CR JEMU_RBINS TTTCTCAAAGCTTCTGCCTCA Loxodonta & Elephas DNADD
Ele-COL6A3-R2 Reverse Mitochondrion cytb-CR JEMU_RBINS CAGTTGTCTGTGTTAGGTGCTTG Loxodonta & Elephas DNADD
Ele-GSTP1-F1 Forward Mitochondrion cytb-CR JEMU_RBINS CACCGAGGCCCAAGTCAG Loxodonta & Elephas DNADD
Ele-GSTP1-R1 Reverse Mitochondrion cytb-CR JEMU_RBINS GCCAGCACTCACGTAGTTGG Loxodonta & Elephas DNADD
Ele-HBB/D-F1 Forward Mitochondrion cytb-CR JEMU_RBINS CCGGAGGTTCTTTGAACACTT Loxodonta & Elephas DNADD
Ele-HBB/D-F2 Forward Mitochondrion cytb-CR JEMU_RBINS GACCCGGAGGTTCTTTGAA Loxodonta & Elephas DNADD
Ele-HBB/D-R1 Reverse Mitochondrion cytb-CR JEMU_RBINS TCACCAAAGGAGGTCAACACT Loxodonta & Elephas DNADD
Ele-HBB/D-R2 Reverse Mitochondrion cytb-CR JEMU_RBINS CCAAAGGAGGTCAACACTTTC Loxodonta & Elephas DNADD
Ele-IARS-F1 Forward Mitochondrion cytb-CR JEMU_RBINS AAGAGCCGTATTCATGATTTTC Loxodonta & Elephas DNADD
Ele-IARS-R1 Reverse Mitochondrion cytb-CR JEMU_RBINS CACACCCTCCTCCTTAAAGC Loxodonta & Elephas DNADD
Ele-ND5-F1 Forward Mitochondrion ND5 JEMU_RBINS AGGAGTTGGCATTATGTCCTT Loxodonta & Elephas DNADD
Ele-ND5-R1 Reverse Mitochondrion ND5 JEMU_RBINS TTGCTTGTAGAGCTGCTGTG Loxodonta & Elephas DNADD
Ele-ND5-R3 Reverse Mitochondrion ND5 JEMU_RBINS YTYAGTGGYGAGCATGAAT Loxodonta & Elephas DNADD
Ele-SPR-F1 Forward Mitochondrion cytb-CR JEMU_RBINS AAGGGCTGGGCACTGTACT Loxodonta & Elephas DNADD
Ele-SPR-R1 Reverse Mitochondrion cytb-CR JEMU_RBINS TTCCCTGCAAAGGACAGACT Loxodonta & Elephas DNADD
LH-COIF2 (aliquot 100 µM) Forward Mitochondrion COI JEMU_RBINS ACRAATCATAAGGATATWGGDACTT Echinodermata: Crinoids MolChaRE
RD2R Reverse Mitochondrion CR JEMU_RBINS CCATGCCGCGTGAAACCA Elaphus cervus DNADD
1100R Reverse Nucleus 18S JEMU_RBINS GATCGTCTTCGAACCTCTG Annelida Cryoli
12SfwHym Forward Mitochondrion 12S JEMU_RBINS gatagtgacgggcaatttgtac Bees HeteroplasHym
16S-3endfwHym Forward Mitochondrion 16S JEMU_RBINS attaaccctgatacaaaaggta Bees HeteroplasHym
16S-5endfwHym Forward Mitochondrion 16S JEMU_RBINS acgctgttatccctaaggta Bees HeteroplasHym
16SA-L Forward Mitochondrion 16S JEMU_RBINS CGCCTGTTTATCAAAAACAT Anura Werneria
16SAR-L-F Forward Mitochondrion 16S JEMU_RBINS CGCCTGTTTATCAAAAACAT Annelida Cryoli
16SB-H Reverse Mitochondrion 16S JEMU_RBINS CCGGTCTGAACTCAGATCACGT Anura Werneria
16SBRH-R Reverse Mitochondrion 16S JEMU_RBINS CCGGTCTGAACTCAGATCACGT Annelida Cryoli
600F Forward Nucleus 18S JEMU_RBINS GGTGCCAGCMGCCGCGGT Annelida Cryoli
660F Forward Nucleus 18S JEMU_RBINS GATCTCGGGTCCAGGCT Annelida Cryoli
Ann16SF Forward Mitochondrion 16S JEMU_RBINS GCGGTATCCTGACCGTRCWAAGGTA Annelida Cryoli
Ann16SR Reverse Mitochondrion 16S JEMU_RBINS TCCTAAGCCAACATCGAGGTGCCAA Annelida Cryoli
C113Rdeg Reverse Mitochondrion COI JEMU_RBINS GGYATWACTATRAARAARATTAT Anura Werneria
co1f Forward Mitochondrion COI JEMU_RBINS CCTGCAGGAGGAGGAGAYCC Anura Werneria
CO2fwHym Forward Mitochondrion COII JEMU_RBINS caatgttcngaaatytgtgg Bees HeteroplasHym
CO2fwWeiHym Forward Mitochondrion COII JEMU_RBINS atwggtcatcartgataytga Bees HeteroplasHym
CO3revHym Reverse Mitochondrion COIII JEMU_RBINS ccctgaaawgttcyttcwcg Bees HeteroplasHym
D3-4048F_(28SD4for) Forward Nucleus 28S-D3-D4 JEMU_RBINS CCCGTCTTGAAACACGGACCAAGG Bees HalAfrEu
D5-4749R_(28SD4rev) Reverse Nucleus 28S-D3-D4 JEMU_RBINS GTTACACACTCCTTAGCGGA Bees HalAfrEu
FWD_16S Palumbi 1996 Forward Mitochondrion 16S JEMU_RBINS CGCCTGTTACCAAAAACAT Anura Werneria
HCO2198Hym Reverse Mitochondrion COI JEMU_RBINS tctgggtncccaaaaaayca Bees HeteroplasHym
HCObisHym Reverse Mitochondrion COI JEMU_RBINS caaaaaaccaaaataaatgttg Bees HeteroplasHym
LCOHym Forward Mitochondrion COI JEMU_RBINS wwtcaacnaatcataaaaatattgg Bees HeteroplasHym
LWRhF_(OpsinFor) Forward Nucleus LW rhodopsin JEMU_RBINS AATTGCTATTAYGARACNTGGGT Bees HalAfrEu
LWRhFor3_(OpsinFor3) Forward Nucleus LW rhodopsin JEMU_RBINS AGATACAACGTRATCGTSAARGGT Bees HalAfrEu
LWRhR_(OpsinRev) Reverse Nucleus LW rhodopsin JEMU_RBINS ATATGGAGTCCANGCCATRAACCA Bees HalAfrEu
MLEPHym Forward Mitochondrion COI JEMU_RBINS gcttttccncgaataaayaatatwag Bees HeteroplasHym
ND5MrevHym Reverse Mitochondrion ND5 JEMU_RBINS ccgrtttcwtctttagttcattc Bees HeteroplasHym
Opsin-For3(mod) Forward Nucleus LW rhodopsin JEMU_RBINS TTCGAYAGATACAACGTRATCGTNAARGG Bees HalAfrEu
OpsinFor4 Forward Nucleus LW rhodopsin JEMU_RBINS GAGAARAAYATGCGBGARCAAGC Bees HalAfrEu
OpsinRev(mod) Reverse Nucleus LW rhodopsin JEMU_RBINS ATANGGNGTCCANGCCATGAACCA Bees HalAfrEu
OpsinRev4 Reverse Nucleus LW rhodopsin JEMU_RBINS GGTGGTGGTRCCGGARACGGTG Bees HalAfrEu
OpsinRev4a Reverse Nucleus LW rhodopsin JEMU_RBINS GGTGGTRCCGGARACGGTGGADGT Bees HalAfrEu
REV_ 16S Palumbi 1996 Reverse Mitochondrion 16S JEMU_RBINS CCGGTTTGAACTCAGATCA Anura Werneria
TimA-F Forward Nucleus 18S JEMU_RBINS AMCTGGTTGATCCTGCCAG Annelida Cryoli
16Sar Reverse Mitochondrion 16S rDNA Malacology_RBINS CGCCTGTTTAACAAAAACAT Invertebrates
16Sbr Forward Mitochondrion 16S rDNA Malacology_RBINS CCGGTCTGAACTCAGATCACGT Invertebrates
262098F Nucleus gibbosus_dimorphism_pos 265 to 280 JEMU_RBINS TACTCTAGGTGGACGGGTTGCATCA Oedothorax_gibbosus Reseq_gibbosus
270,267 F Forward Nucleus gibbosus_downstream_target_region JEMU_RBINS AGTTTTGCGGCACACATCAC Oedothorax_gibbosus Reseq_gibbosus
276007F Nucleus gibbosus_dimorphism_pos 280 to 295 JEMU_RBINS TCCCAGTCTTTCGTTTCCTCTCCCT Oedothorax_gibbosus Reseq_gibbosus
279400F Nucleus gibbosus_dimorphism_pos 280 to 295 JEMU_RBINS ACCATTTCCCCCTTTTTGTCCGACA Oedothorax_gibbosus Reseq_gibbosus
279948F Nucleus gibbosus_dimorphism_pos 280 to 295 JEMU_RBINS GTTAGTTTCCCCGATACGTCCGGTG Oedothorax_gibbosus Reseq_gibbosus
280460R Nucleus gibbosus_dimorphism_pos 280 to 295 JEMU_RBINS ACGACCGACAAATTACTCCAGCTGG Oedothorax_gibbosus Reseq_gibbosus
281275R Nucleus gibbosus_dimorphism_pos 280 to 295 JEMU_RBINS TGAGCTGTCAGAGAAAGACCCGGTA Oedothorax_gibbosus Reseq_gibbosus
288,914 R Reverse Nucleus gibbosus_downstream_target_region JEMU_RBINS TTTTCTCCCCACAGCGAGTC Oedothorax_gibbosus Reseq_gibbosus
289,202 R Reverse Nucleus gibbosus_downstream_target_region JEMU_RBINS AGCCGCAACCAAATATCCCA Oedothorax_gibbosus Reseq_gibbosus
289,631 R Reverse Nucleus gibbosus_downstream_target_region JEMU_RBINS TAGAAAACGTGCCGCCTCAT Oedothorax_gibbosus Reseq_gibbosus
293962F Nucleus gibbosus_dimorphism_pos 295 to 310 JEMU_RBINS GGGGTTTTGTCAAATGCGCATGGAT Oedothorax_gibbosus Reseq_gibbosus
294658F Nucleus gibbosus_dimorphism_pos 295 to 310 JEMU_RBINS TCCGCGGTCGAATCCCAAACAATAA Oedothorax_gibbosus Reseq_gibbosus
295055R Nucleus gibbosus_dimorphism_pos 295 to 310 JEMU_RBINS CGGTGAAAACGGCTTGCTGAAACTT Oedothorax_gibbosus Reseq_gibbosus
296051R Nucleus gibbosus_dimorphism_pos 295 to 310 JEMU_RBINS TTGTATCAAAGCGCGGGAAGGATGT Oedothorax_gibbosus Reseq_gibbosus
297,721 F Forward Nucleus gibbosus_upstream_target_region JEMU_RBINS AAGTTCTGCCTGATCCCACG Oedothorax_gibbosus Reseq_gibbosus
297744R Nucleus gibbosus_dimorphism_pos 280 to 295 JEMU_RBINS CAGTCGTGGGATCAGGCAGAACTTT Oedothorax_gibbosus Reseq_gibbosus
298,407 F Forward Nucleus gibbosus_upstream_target_region JEMU_RBINS ATCGTGGAAGGAGGCGTTTT Oedothorax_gibbosus Reseq_gibbosus
308648F Nucleus gibbosus_dimorphism_pos 310 to 325 JEMU_RBINS CCCTCCGAGTACTTTTTCGACACCC Oedothorax_gibbosus Reseq_gibbosus
313,461 R Reverse Nucleus gibbosus_dimorphism_pos 265 to 280 JEMU_RBINS TTTCCTTCGGTGCTACGCTT Oedothorax_gibbosus Reseq_gibbosus
313709R Nucleus gibbosus_dimorphism_pos 310 to 325 JEMU_RBINS AGAGAGCGCAGGGAAAGGAAAAGTC Oedothorax_gibbosus Reseq_gibbosus
313912R Nucleus gibbosus_dimorphism_pos 310 to 325 JEMU_RBINS AGGGAGGAGGGTGAAGTGTCAGTAC Oedothorax_gibbosus Reseq_gibbosus
316,070 R Reverse Nucleus gibbosus_upstream_target_region JEMU_RBINS ATGCGCTTTTTCTTTGSCGT Oedothorax_gibbosus Reseq_gibbosus
325305R Nucleus gibbosus_upstream_target_region JEMU_RBINS ACTCCTTCTCGCCCTCGTGAAAATG Oedothorax_gibbosus Reseq_gibbosus
327059R Nucleus gibbosus_dimorphism_pos JEMU_RBINS ACCGTCTTTAAGGGGTTAAGGCAGC Oedothorax_gibbosus Reseq_gibbosus
COI_Squatina1F Forward Mitochondrion COI JEMU_RBINS GCCCACGCTTTGGTGATAATTT Squatina squatina Squatina
COI_Squatina1R Reverse Mitochondrion COI JEMU_RBINS AAGGAAGGAGGCAAAAGTCAGA Squatina squatina Squatina
COI_Squatina2F Forward Mitochondrion COI JEMU_RBINS TTGCAGGAAATTTAGCTCACGC Squatina squatina Squatina
COI_Squatina2R Reverse Mitochondrion COI JEMU_RBINS TTGATACTGGGAAATGGCTGGG Squatina squatina Squatina
EF1 Forward Nucleus F2 copy of EFl-alpha JEMU_RBINS AAGATCGGTGGTATCGGTAC Bees HalAfrEu
EF2 Reverse Nucleus F2 copy of EFl-alpha JEMU_RBINS TGGTGAGCGCTGCTGGAG Bees HalAfrEu
EmphF2for Forward Nucleus F2 copy of EFl-alpha JEMU_RBINS GCCTGGGTATTGGATAAGCTGAA Bees HalAfrEu
EmphF2rev Reverse Nucleus F2 copy of EFl-alpha JEMU_RBINS TGGATTGTTYTTRGAGTCACCAG Bees HalAfrEu
F2rev-ERROR-take F2-Rev1 Reverse Nucleus F2 copy of EFl-alpha JEMU_RBINS AATCAGCACCTTTAGGTGG Bees HalAfrEu
For1-deg Forward Nucleus EF1-alpha JEMU_RBINS GYATCGACAARCGTACSATYG Bees HalAfrEu
H15149_Kocher Forward Mitochondrion cob - cytb JEMU_RBINS AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA Mammals Squatina
H15149_short Forward Mitochondrion cob - cytb JEMU_RBINS GCCCCTCAGAATGATATTTGTCCTCA Mammals Squatina
HaF2for1 Forward Nucleus F2 copy of EFl-alpha JEMU_RBINS GGGYAAAGGWTCCTTCAARTATGC Bees HalAfrEu
LCO_KY464954 Forward Mitochondrion COI JEMU_RBINS TCTCTACAAATCACAAAGATATTGG Squatina squatina Squatina
Lep-Wg1a-For_(wg1a) Forward Nucleus Wingless JEMU_RBINS GARTGYAARTGYCAYGGYATGTCTGG Bees HalAfrEu
LSU-2 Forward Nucleus 28S rDNA Malacology_RBINS GGGTTGTTTGGGAATGCAGC Invertebrates
LSU-5 Reverse Nucleus 28S rDNA Malacology_RBINS GTTAGACTCCTTGGTCCGTG Invertebrates
Uni-MinibarF1-squatina Forward Mitochondrion COI JEMU_RBINS CTACAAATCACAAAGATATTGGCAC Squatina squatina Squatina
Uni-MinibarR1-squatina Reverse Mitochondrion COI JEMU_RBINS ATTATCACCAAAGCGTGGGC Squatina squatina Squatina
Wg-Collet-For Forward Nucleus Wingless JEMU_RBINS CACGTGTCBTCBGRGATGMGRSAGGA Bees HalAfrEu
1100R Reverse Nucleus 18S JEMU_RBINS (aliquot) GATCGTCTTCGAACCTCTG Annelida Cryoli
16SAR-L-F Forward Mitochondrion 16S JEMU_RBINS (aliquot) CGCCTGTTTATCAAAAACAT Annelida Cryoli
16SBRH-R Reverse Mitochondrion 16S JEMU_RBINS (aliquot) CCGGTCTGAACTCAGATCACGT Annelida Cryoli
272,857 F Forward Nucleus gibbosus_downstream_target_region JEMU_RBINS GACTGACGCCTGTTCCTGAA Oedothorax_gibbosus Reseq_gibbosus
286010F Forward Nucleus gibbosus_target_region JEMU_RBINS CCTGCATTTCCTCGGATAGGT Oedothorax_gibbosus Reseq_gibbosus
28SC1’-F Forward Nucleus 28S JEMU_RBINS (aliquot) ACCCGCTGAATTTAAGCAT Annelida Cryoli
28SC2-R Reverse Nucleus 28S JEMU_RBINS (aliquot) TGAACTCTCTCTTCAAAGTTCTTTTC Annelida Cryoli
290287F Forward Nucleus gibbosus_homo_gap_291k_outout JEMU_RBINS CCAGCAATTTGGGAGGGGAT Oedothorax_gibbosus Reseq_gibbosus
290640F Forward Nucleus gibbosus_homo_gap_291k_outout JEMU_RBINS TGTGAARGTCRTGAGTGGGA Oedothorax_gibbosus Reseq_gibbosus
291295R Reverse Nucleus gibbosus_homo_gap_291k_outout JEMU_RBINS ACCTGCCCAAATAAACTTTACACT Oedothorax_gibbosus Reseq_gibbosus
291858R Reverse Nucleus gibbosus_homo_gap_291k_outout JEMU_RBINS ACACAGCACAAGGGGAAYAT Oedothorax_gibbosus Reseq_gibbosus
292120R Reverse Nucleus gibbosus_homo_gap_291k_outout JEMU_RBINS TTATTGTGCACAGCGCTTGG Oedothorax_gibbosus Reseq_gibbosus
293288F Forward Nucleus gibbosus_hetero_gap_293k_outout JEMU_RBINS TGACAGTCATAAAGCTCTGTTRAA Oedothorax_gibbosus Reseq_gibbosus
293731R Reverse Nucleus gibbosus_hetero_gap_293k_outout JEMU_RBINS AAAGCGCGGGAAGGATGTAT Oedothorax_gibbosus Reseq_gibbosus
293736R Reverse Nucleus gibbosus_hetero_gap_293k_outout JEMU_RBINS GTATCAAAGCGCGGGAAGGA Oedothorax_gibbosus Reseq_gibbosus
296339F Forward Nucleus gibbosus_hetero_gap_297k_outout JEMU_RBINS TAATTCGGAGAAGGCTCGCC Oedothorax_gibbosus Reseq_gibbosus
296395F Forward Nucleus gibbosus_hetero_gap_297k_outout JEMU_RBINS CGAGGCGTTGGTTTGAAAGG Oedothorax_gibbosus Reseq_gibbosus
296679F Forward Nucleus gibbosus_hetero_gap_297k_inout JEMU_RBINS AGAACGGAATGGAAGCGAGT Oedothorax_gibbosus Reseq_gibbosus
296682F Forward Nucleus gibbosus_hetero_gap_297k_inout JEMU_RBINS ACGGAATGGAAGCGAGTTCT Oedothorax_gibbosus Reseq_gibbosus
296698F Forward Nucleus gibbosus_hetero_gap_297k_inout JEMU_RBINS TTCTTGAGAAGTCCCTGGCC Oedothorax_gibbosus Reseq_gibbosus
297325F Forward Nucleus gibbosus_hetero_gap_297k_inin JEMU_RBINS TGTCAGTTCAGCTCTTCCGT Oedothorax_gibbosus Reseq_gibbosus
297337F Forward Nucleus gibbosus_hetero_gap_297k_inin JEMU_RBINS GCTCTTCCGTTTCAAAGTGACG Oedothorax_gibbosus Reseq_gibbosus
297760R Reverse Nucleus gibbosus_hetero_gap_297k_inout JEMU_RBINS CGCGAGCCAAACGATCAAAA Oedothorax_gibbosus Reseq_gibbosus
297771R Reverse Nucleus gibbosus_hetero_gap_297k_inout JEMU_RBINS CGTAAAAACAACGCGAGCCA Oedothorax_gibbosus Reseq_gibbosus
297787R Reverse Nucleus gibbosus_hetero_gap_297k_inin JEMU_RBINS CGATCCCTACCCCACTCGTA Oedothorax_gibbosus Reseq_gibbosus
298028R Reverse Nucleus gibbosus_hetero_gap_297k_outout JEMU_RBINS AGCTTGGAAGGGAAGCAAGA Oedothorax_gibbosus Reseq_gibbosus
301048R Reverse Nucleus gibbosus_target_region JEMU_RBINS CCCCCACAGACACACTTACC Oedothorax_gibbosus Reseq_gibbosus
301160R Reverse Nucleus gibbosus_target_region JEMU_RBINS CAACAATCATCCCACCCCGA Oedothorax_gibbosus Reseq_gibbosus
302382R Reverse Nucleus gibbosus_target_region JEMU_RBINS AGAAGTAGGGGAGGCTGAGG Oedothorax_gibbosus Reseq_gibbosus
4fb-F Forward Nucleus 18S JEMU_RBINS (aliquot) CCAGCAGCCGCGGTAATTCCAG Annelida Cryoli
4fbk-R Reverse Nucleus 18S JEMU_RBINS (aliquot) CTGGAATTACCGCGGCTGCTGG Annelida Cryoli
5.8mussF Forward Nucleus ITS JEMU_RBINS (aliquot) CGCAGCCAGCTGCGTGAATTAATGT Annelida Cryoli
5.8mussR Reverse Nucleus ITS JEMU_RBINS (aliquot) GATGTCGATGTTCAATGTGTCCTGC Annelida Cryoli
600F Forward Nucleus 18S JEMU_RBINS (aliquot) GGTGCCAGCMGCCGCGGT Annelida Cryoli
660F Forward Nucleus 18S JEMU_RBINS (aliquot) GATCTCGGGTCCAGGCT Annelida Cryoli
Ann16SF Forward Mitochondrion 16S JEMU_RBINS (aliquot) GCGGTATCCTGACCGTRCWAAGGTA Annelida Cryoli
Ann16SR Reverse Mitochondrion 16S JEMU_RBINS (aliquot) TCCTAAGCCAACATCGAGGTGCCAA Annelida Cryoli
COI-E-R Reverse Mitochondrion COI JEMU_RBINS (aliquot) TATACTTCTGGGTGTCCGAAGAATCA Annelida Cryoli
H3F Forward Nucleus H3 JEMU_RBINS (aliquot) ATGGCTCGTACCAAGCAGACVGC Annelida Cryoli
H3R Reverse Nucleus H3 JEMU_RBINS (aliquot) ATATCCTTRGGCATRATRGTGAC Annelida Cryoli
holo2F Forward Mitochondrion COI JEMU_RBINS (aliquot) TGAAAAACATGAGMTTCTGA Holothurian MolChaRE
holo2R1 Reverse Mitochondrion COI JEMU_RBINS (aliquot) TTCTTGCTTWCCTCTGTA Holothurian MolChaRE
holo2R2 Reverse Mitochondrion COI JEMU_RBINS (aliquot) CATTCCTAAGTAGCCRAA Holothurian MolChaRE
ITS-4-R Reverse Nucleus ITS JEMU_RBINS (aliquot) TCCTCCGCTTATTGATATGC Annelida Cryoli
ITS-5-F Forward Nucleus ITS JEMU_RBINS (aliquot) GGAAGTAAAAGTCGTAACAAGG Annelida Cryoli
LoboF1 Forward Mitochondrion COI JEMU_RBINS (aliquot) KBTCHACAAAYCAYAARGAYATHGG Echinodermata MolChaRE
LoboR1 Reverse Mitochondrion COI JEMU_RBINS (aliquot) TAAACYTCWGGRTGWCCRAARAAYCA Echinodermata MolChaRE
MtD9 Reverse Mitochondrion COI JEMU_RBINS CCCGGTAAAATTAAAATATAAACTTC corbiculate bees Halictidae
TimA-F Forward Nucleus 18S JEMU_RBINS (aliquot) AMCTGGTTGATCCTGCCAG Annelida Cryoli
TimB-R Reverse Nucleus 18S JEMU_RBINS (aliquot) TGATCCATCTGCAGGTTCACCT Annelida Cryoli
18S3F Forward Nucleus 18S JEMU_RBINS GTTCGATTCCGGAGAGGGA universal MolChaRE
18S5R Reverse Nucleus 18S JEMU_RBINS CTTGGCAAATGCTTTCGC universal MolChaRE
18SA2.0 Forward Nucleus 18S JEMU_RBINS ATGGTTGCAAAGCTGAAAC universal MolChaRE
aBelcan_13706_R Reverse Nucleus aBelcan JEMU_RBINS AGTGAAGAGGCTATGGGTATTG Canids Canids
BarbeeF Forward Mitochondrion COI JEMU_RBINS CAACAAATCATAAAAATATTGG corbiculate bees Halictidae
birdF1 Forward Mitochondrion COI Derycke Sofie TTCTCCAACCACAAAGACATTGGCAC birds BarCoVer
birdr1 Reverse Mitochondrion COI Derycke Sofie ACGTGGGAGATAATTCCAAATCCTG birds BarCoVer
CO1-2166F Forward Mitochondrion COI JEMU_RBINS GGAGGATTTGGTAATTTTTTAATTCC corbiculate bees Halictidae
CO1-2248R Reverse Mitochondrion COI JEMU_RBINS CAAAATCTAATATTATTTATTCG corbiculate bees Halictidae
CO1-2338F Forward Mitochondrion COI JEMU_RBINS CATATTTATATCATTCATCTCC corbiculate bees Halictidae
CO1-2386R Reverse Mitochondrion COI JEMU_RBINS GAAAAAATTGTAAAATCAAC corbiculate bees Halictidae
COI-E- Forward Mitochondrion COI JEMU_RBINS tatacttctgggtgtccgaagaatca oligochaetes Cryoli
COIeF Forward Mitochondrion COI JEMU_RBINS ATAATGATAGGAGGRTTTGG Echinodermata MolChaRE
COIeR Reverse Mitochondrion COI JEMU_RBINS GCTCGTGTRTCTACRTCCAT Echinodermata MolChaRE
COIF(b11834) Forward Mitochondrion COI JEMU CAACAAATCATAAAGATATTGG insects
COIF(tl1862) Forward Mitochondrion COI JEMU TACTTCGTATTCGGAGCTTGA insects
COIR(th2397) Reverse Mitochondrion COI JEMU GTTAGTAGTATTGTGATTGCTCC insects
COIR(th2472) Reverse Mitochondrion COI JEMU AATA?GTGTTGGTATAGGAT insects
EchinoF1 Forward Mitochondrion COI JEMU_RBINS TTTCAACTAATCATAAGGACATTGG Echinodermata MolChaRE
EchinoR1 Reverse Mitochondrion COI JEMU_RBINS CTTCAGGGTGTCCAAAAAATCA Echinodermata MolChaRE
Efint_f1 Forward Nucleus Elongation factor JEMU_RBINS AGAGATTTYATTAARAACATGAT Diptera BC42W
Efint_f2 Forward Nucleus Elongation factor JEMU_RBINS ATTGTWGCNGCYGGTACTGGTGAA Diptera BC42W
Efint_r Reverse Nucleus Elongation factor JEMU_RBINS ACAATAGCRGCATCACCWGAT Diptera BC42W
H15149 Reverse Mitochondrion cytochrome b (cob) JEMU_RBINS GCCCCTCAGAATGATATTTGTCCTCA Vertebrates
LH-COIF2 Forward Mitochondrion COI JEMU_RBINS ACRAATCATAAGGATATWGGDACTT Echinodermata: Crinoids MolChaRE
mt1stND1Fmod Forward Mitochondrion ND1 JEMU_RBINS TTCWGATTCWCCTTCWGCAAAATC Syrphidae:Eristalinae SYRPHIDS
mt1stND1Rmod Reverse Mitochondrion ND1 JEMU_RBINS TAGGWTATATTCARATTCGTAARGG Syrphidae:Eristalinae SYRPHIDS
mt1stND5Fmod=rev Reverse Mitochondrion ND5 JEMU_RBINS GATGGDTTAGGWTTAGTWTCTTA Syrphidae:Eristalinae SYRPHIDS
mt1stND5Rmod=fwd Forward Mitochondrion ND5 JEMU_RBINS CCTATTAAACGYAARTCYTG Syrphidae:Eristalinae SYRPHIDS
PUN-CCR-F Forward Mitochondrion Control region JEMU_RBINS CACCTGGCCTCGAGAAAC Feliformia
PUN-CCR-F173 Forward Mitochondrion Control region JEMU_RBINS CAACTTTCTCAAATAGGACATCTCG Feliformia
PUN-CCR-R Reverse Mitochondrion Control region JEMU_RBINS TATATGTCCTGCGACCATTGA Feliformia
PUN-CCR-R254 Reverse Mitochondrion Control region JEMU_RBINS CCAAATGCATGACACCACAG Feliformia
R_C1N2659t Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACGCTAATCCAGTGAATAATGG Diptera:calliphoridae BC42W
Ron Forward Mitochondrion COI JEMU_RBINS GGAGCYCCWGATATAGCTTTCCC universal Halictidae
TK-N-3814mod Reverse Mitochondrion COII JEMU_RBINS TTAaAAGTAAgTGCTARATTAC Syrphidae:Eristalinae SYRPHIDS
TK-N3796mod Reverse Mitochondrion COII JEMU_RBINS ACTATaAcATGGTTTAAGAG Syrphidae:Eristalinae SYRPHIDS
TL2-J-3045 Forward Mitochondrion COII JEMU_RBINS GATTAGTGCAATGGATTTAAGC Syrphidae:Eristalinae SYRPHIDS
16SXiF Forward Nucleus 16S JEMU CGCTGTTATCCCTAAGGTAA Diptera:Sarcophagidae NICC
16SXiR Reverse Nucleus 16S JEMU CTGGTATGAAAGGTTTGACG Diptera:Sarcophagidae NICC
aBelcan_10895_F Forward Nucleus aBelcan JEMU_RBINS ACTTGCCGCTGTACTCCTA Canids Canids
aBelcan_11024_R Reverse Nucleus aBelcan JEMU_RBINS GCTTGTTATGATTATGCCTCA Canids Canids
aBelcan_13594_F Forward Nucleus aBelcan JEMU_RBINS CCACGGGTAACTTCCATGAT Canids Canids
aBelcan_4293_F Forward Nucleus aBelcan JEMU_RBINS CAGGAATAATCCTACTAACATGACAA Canids Canids
aBelcan_4433_R Reverse Nucleus aBelcan JEMU_RBINS TTTGATTTAGTCCGCCTCAG Canids Canids
aBelcan_6218_F Forward Nucleus aBelcan JEMU_RBINS TCACCATATGTTTACCGTAGGA Canids Canids
aBelcan_6307_R Reverse Nucleus aBelcan JEMU_RBINS TTTACTCCCGTTGGAATAGC Canids Canids
aBelcan_8485_F Forward Nucleus aBelcan JEMU_RBINS GATTGGAGGGGCTACCTTAG Canids Canids
aBelcan_8613_R Reverse Nucleus aBelcan JEMU_RBINS AAGGTAAAAACATAGGCTTGAA Canids Canids
TSIN11683t Reverse Nucleus cytochrome b (cob) JEMU CAGGAAACAGCTATGACAAATTCTATCTTATGTTTTCAAAAC Diptera:Sarcophagidae NICC
ASP_f Forward Nucleus Asp JEMU TCAGAATTTACGATCTATTC Diptera:Sarcophagidae NICC
ASP_R Reverse Nucleus Asp JEMU AACCTGTTCTTTGAGGABCC Diptera:Sarcophagidae NICC
CBJ10933t Forward Mitochondrion cytochrome b (cob) JEMU TGTAAAACGACGGCCAGTTATGTTTTACCTTGAGGACAAATATC Diptera Diptera
COIIF Forward Mitochondrion COII CAGATAAGTGCATTGGATTT Diptera Diptera
COIIR Reverse Mitochondrion COII GTTTAAGAGACCAGTACTTG Diptera Diptera
CYT_LEP_H Reverse Mitochondrion cytochrome b (cob) JEMU_RBINS GGCTTACAAGGCCGGGGTAA Diptera Diptera
CYT_LEP_L Forward Mitochondrion cytochrome b (cob) JEMU_RBINS AATGATATGAAAAACCATCGTTGTA Diptera Diptera
EFF05t Forward Nucleus Elongation factor JEMU TGTAAAACGACGGCCAGTCCTGGACATCGTGATTTCAT Diptera:Sarcophagidae NICC
EFF06t Forward Nucleus Elongation factor JEMU CAGGAAACAGCTATGACTTACCTTCAGCGTTACCTTC Diptera:Sarcophagidae NICC
HCO2198 Reverse Mitochondrion COI JEMU TAAACTTCAGGGTGACCAAAAAATCA universal BarCoVer
LCO1490 Forward Mitochondrion COI JEMU GGTCAACAAATCATAAAGATATTGG universal BarCoVer
PDRWR04t Reverse Nucleus cytochrome b (cob) JEMU CAGGAAACAGCTATGACATTTCACGCTCATTAACT Diptera Diptera
WhitegeneHalF1 Forward Nucleus Whitegene JEMU_RBINS ATCGCCGTACAARGCAWCTTGGT Halictidae Halictus
WhitegeneHalF2 Forward Nucleus Whitegene JEMU_RBINS CGAACAATTTCGCGCGGTTCT Halictidae Halictus
WhitegeneHalF3 Forward Nucleus Whitegene JEMU_RBINS TGGCTATCCGTCGTCAARGA Halictidae Halictus
WhitegeneHalR1 Reverse Nucleus Whitegene JEMU_RBINS ATGGGTTCYTTGAYGACGGATAGC Halictidae Halictus
WhitegeneHalR2 Reverse Nucleus Whitegene JEMU_RBINS TTGATGAGRATGGGTTCYTTGA Halictidae Halictus
WhitegeneHalR3 Reverse Nucleus Whitegene JEMU_RBINS TCTGCAGCAACCGRAYCTTGA Halictidae Halictus
WhitegeneHalR4 Reverse Nucleus Whitegene JEMU_RBINS CGCAAGWACGTACRACGGTCT Halictidae Halictus
wsp F1 Forward Wolbachia surface protein JEMU_RBINS GTCCAATARSTGATGARGAAAC Wolbachia Halictus
wsp R1 Forward Wolbachia surface protein JEMU_RBINS CYGCACCAAYAGYRCTRTAAA Wolbachia Halictus
Bird_H153_175d Reverse Mitochondrion COI JEMU ACGATTACRTTGTARATYTGRTC Birds BarCoVer
Bird_H351_370d Reverse Mitochondrion COI JEMU CCTGCTCCWGCTTCTAYDGT Birds BarCoVer
CB-J-10933 Forward Mitochondrion Cytb JEMU TATGTACTACCATGAGGACAAATATC sawflies ECES_PSEU
CB-N-11367 Reverse Mitochondrion Cytb JEMU ATTACACCTCCTAATTTATTAGGAAT sawflies ECES_PSEU
Cytb238 NA Mitochondrion Cytb JEMU CGACAACTACACTTAAACGGAGCA elephant_ID BarCoVer
Cytb389 NA Mitochondrion Cytb JEMU CCTATGAAGGCGGTGGTTATG elephant_ID BarCoVer
FF2d_1_ Forward Mitochondrion COI JEMU TTCTCCACCAACCACAARGAYATYGG fishes BarCoVer
FishF2_t1 Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC fish_mammal_cocktail BarCoVer
FishR2_t1 Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA fish_mammal_cocktail BarCoVer
FR1d_1_ Reverse Mitochondrion COI JEMU CACCTCAGGGTGTCCGAARAAYCARAA fishes BarCoVer
LEP-F1 Forward Mitochondrion COI JEMU ATTCAACCAATCATAAAGATAT lepidoptera_fishes_etc BarCoVer
LEP-R1 Reverse Mitochondrion COI JEMU TAAACTTCTGGATGTCCAAAAA lepidoptera_fishes_etc BarCoVer
LEP-R2 Reverse Mitochondrion COI JEMU CTTATATTATTTATTCGTGGGAAAGC lepidoptera_fishes_etc BarCoVer
LepF1_t1 Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG Mammal_rept_fish_amph_cocktail BarCoVer
LepR1_t1 Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAAATCA Mammal_rept_fish_amph_cocktail BarCoVer
M13F Forward NA tail for seq (no marker) JEMU TGTAAAACGACGGCCAGT for PCR cocktail BarCoVer
M13R Reverse NA tail for seq (no marker) JEMU CAGGAAACAGCTATGAC for PCR cocktail BarCoVer
PTPN12_f1 Forward Nucleus PTPN JEMU AGTTGCCTTGTWGAAGGRGATGC Mammals BarCoVer_Mammals
PTPN12_f1mam Forward Nucleus PTPN JEMU AGTTGCCTTGTAGAAGGGGATGC Mammals BarCoVer_Mammals
PTPN12_r6 Reverse Nucleus PTPN JEMU CTRGCAATKGACATYGGYAATAC Mammals BarCoVer_Mammals
PTPN12_r6mam Reverse Nucleus PTPN JEMU CTRGCAATGGACATYGGYAATAC Mammals BarCoVer_Mammals
VF1_t1 Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTTCTCAACCAACCACAAAGACATTGG Mammal_rept_fish_amph_cocktail BarCoVer
VF1d_t1 Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTTCTCAACCAACCACAARGAYATYGG Mammal_rept_fish_amph_cocktail BarCoVer
VR1_t1_ Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCAAAGAATCA Mammal_rept_fish_amph_cocktail BarCoVer
VR1d_t1 Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA Mammal_rept_fish_amph_cocktail BarCoVer
16SA Forward Mitochondrion 16S EVA CGCCTGTTTATCAAAAACAT NA Oonopidae
16SB Reverse Mitochondrion 16S EVA CTCCGGTTTGAACTCAGATCA NA Oonopidae
18S3F Forward Nucleus 18S EVA GTTCGATTCCGGAGAGGGA NA Oonopidae
18S5R Reverse Nucleus 18S EVA CTTGGCAAATGCTTTCGC NA Oonopidae
Actin-F-254 Forward Nucleus Actin EVA ACNAACTGGGATGATATGGAGAA NA Oonopidae
Actin-R-1009 Reverse Nucleus Actin EVA CCNCCRATCCANACGGARTACTT NA Oonopidae
Actin5C-F-229 Forward Nucleus Actin EVA AAGTATCCNATTGAGCATGGTATTG NA Oonopidae
Actin5C-R-1057 Reverse Nucleus Actin EVA TTNGADATCCACATTTGTTGGAA NA Oonopidae
COI-2183R2 Reverse Mitochondrion COI EVA CCAAAAAATCAAAATARATGYTG NA Oonopidae
PRLR_r3mam Reverse Nucleus PRLR JEMU GACYTTGTGAATCTCCACRTAATC Mammals BarCoVer_Mammals
SRY3F1____ Forward Nucleus SRY JEMU CATGTAAAGAATTCAGACTTTCC Mammals BarCoVer_Mammals
SRY3R1____ Reverse Nucleus SRY JEMU CCATCTAACTAATGACCAATCTC Mammals BarCoVer_Mammals
SRY3R2_ Reverse Nucleus SRY JEMU AGGGAGCTTTCCATCCAAGTAC Mammals BarCoVer_Mammals
SRY5F__40_________ Forward Nucleus SRY JEMU CCTGTTAAGTAGCTTTGCTTGAG Mammals BarCoVer_Mammals
SRY5R_______ Reverse Nucleus SRY JEMU CACAGCTGGACTGTAAACATCGT Mammals BarCoVer_Mammals
UBN1_f1mam Forward Nucleus UBN JEMU CCYCTCAATTTTCTGGCWGARCAGGCT Mammals BarCoVer_Mammals
UBN1_r2 Reverse Nucleus UBN JEMU GGTCAGYAAYTTKGCCACHCCYT Mammals BarCoVer_Mammals
UBN1_r2mam Reverse Nucleus UBN JEMU GGTCAGYAAYTTKGCCACHCCCT Mammals BarCoVer_Mammals
Aves_H534_556 Reverse Mitochondrion COI Jemu ACGAATAGGGGGGTTTGGTATTG birds BarCoVer
Aves_H534_556d Reverse Mitochondrion COI Jemu ACGAATAGGGGGGTTTGRTAYTG birds BarCoVer
Aves_L288_310 Forward Mitochondrion COI Jemu CGCATAAACAACATAAGCTTCTG birds BarCoVer
Aves_L288_310d Forward Mitochondrion COI Jemu CGCATAAAYAACATAAGCTTYTG birds BarCoVer
Aves_L501_523 Forward Mitochondrion COI Jemu ACCGCCATCAACATAAAACCCCC birds BarCoVer
Aves_L501_523d Forward Mitochondrion COI Jemu ACCGCCATCAACATAAAACCNCC birds BarCoVer
birdR1d Reverse Mitochondrion COI Jemu ACGTGGGAGATGATTCCGAAKCCKGG birds BarCoVer
Glu-2_ NA NA Glu Synodontis AACCACCGTTGTTATTCAACTA Synodontis NA
Glyt_F559 Forward NA Glyt Vertebrates GGACTGTCMAAGATGACCACMT Fishes NA
Glyt_F577 Forward NA Glyt Vertebrates ACATGGTACCAGTATGGCTTTGT Fishes NA
Glyt_R1464 Reverse NA Glyt Vertebrates GTAAGGCATATASGTGTTCTCTCC Fishes NA
Glyt_R1562 Reverse NA Glyt Vertebrates CCCAAGAGGTTCTTGTTRAAGAT Fishes NA
Gor_H333_354 Reverse Mitochondrion COI Jemu TACTATAGCGGATGCGAGCAGA Gorillas BarPan
Hom_H151_173 Reverse Mitochondrion COI Jemu ACAATGACATTATAGATGTGGTC Hominids BarPan
Hom_H349_368 Reverse Mitochondrion COI Jemu CCGGCGCCGGCTTCTACTAT Hominids BarPan
Hom_H706_731 Reverse Mitochondrion COI Jemu TAAACTTCGGGGTGGCCAAAAAATCA Hominids BarPan
Hom_L25_50 Forward Mitochondrion COI Jemu TCTACAAACCACAAAGATATTGGAAC Hominids BarPan
IcCytb-F1_ Forward Mitochondrion cytb Synodontis TTTYTACAYGAAACVGGCTCCAA Synodontis NA
IcCytb-R1_ Reverse Mitochondrion cytb Synodontis TTGGAGCCBGTTTCRTGTARAAA Synodontis NA
ICytb-F1_ Forward Mitochondrion Cytb Synodontis TTCCTTYCACCCCTATTTCT Synodontis NA
ICytb-R1_ Reverse Mitochondrion Cytb Synodontis CTGGGGTGAAGTTTTCTGGG Synodontis NA
Pan_H165_187 Reverse Mitochondrion COI Jemu ACGCATGGGCTGTGACAATGACA Pan_paniscus BarPan
Pan_H333_354 Reverse Mitochondrion COI Jemu TACTATGGCAGATGCAAGTAGA Pan_paniscus BarPan
Pan_H336_357 Reverse Mitochondrion COI Jemu TTCTACTATGGCAGATGCAAGT Pan_paniscus BarPan
Pro-R1_ Reverse NA Pro Synodontis TAGTTTAGTTTAGAATTCTGGCTTTGG Synodontis NA
Psic16Sf Forward Mitochondrion 16S Robin_Rotsaert TAACCGTGCAAAGGTAGCATAA reptiles Podarcis
Psic16Sr Reverse Mitochondrion 16S Robin_Rotsaert ATCCAACATCGAGGTCGTAAAC reptiles Podarcis
PsiCo1aF5266 Forward Mitochondrion COI Robin_Rotsaert TATTACTCAGCCATCCTACCTGTGT reptiles Podarcis
PsiCo1aR5753 Reverse Mitochondrion COI Robin_Rotsaert GARACTCCTGCTARATGAAGTGAAA reptiles Podarcis
PsiCo1bF5554 Forward Mitochondrion COI Robin_Rotsaert CCTGACATAGCATTTCCACGAATA reptiles Podarcis
PsiCo1bR6007 Reverse Mitochondrion COI Robin_Rotsaert GTGACCAAAGAATCAGAAYAGGTGT reptiles Podarcis
Psico1dF Forward Mitochondrion COI Robin_Rotsaert GCGCTCCTGACATAGCATT reptiles Podarcis
Psico1dR Reverse Mitochondrion COI Robin_Rotsaert TCTGGGTGACCAAAGAATCA reptiles Podarcis
Thr-R1_ Reverse NA Thr Synodontis TTTAGAATTCTGGCTTTGGGAG Synodontis NA
12Sf Forward Mitochondrion 12S Jemu TACTATGTTACGACTTAT Termites DAG
12Sr Reverse Mitochondrion 12S Jemu AAACTAGGATTAGATACCC Termites DAG
28S_rD5a-CARPLAT Reverse Nucleus 28S_rDNA Frederik_Hendrickx GGYGTTGGTTGCTTAAGACAG Platynini_(Carabidae) NA
28S_rD6b-CARPLAT Reverse Nucleus 28S_rDNA Frederik_Hendrickx AACCRGATTCCCTTTCGCC Platynini_(Carabidae) NA
28Sa-CARPLAT NA Nucleus 28S_rDNA Frederik_Hendrickx GACCCGTCTTGAAACACGGA Platynini_(Carabidae) NA
28Sb-CARPLAT NA Nucleus 28S_rDNA Frederik_Hendrickx TCGGAAGGAACCAGCTACTA Platynini_(Carabidae) NA
28SfGink Forward Nucleus 28S Jemu GACCAAGGAGTCTAACATGTGC Termites DAG
28SfHux Forward Nucleus 28S Jemu ACACGGACCAAGGAGTCTAAC Termites DAG
28SfMB2 Forward Nucleus 28S Jemu TCTAACATGTGCGCGAGTC Termites DAG
28SrGPW2 Reverse Nucleus 28S Jemu GCAACCAACGCCTTTCA Termites DAG
28SrGPW3 Reverse Nucleus 28S Jemu TTAACCCGGCGTTTGGTTC Termites DAG
28SrWin Reverse Nucleus 28S Jemu GTCCTGCTGTCTTAAGCAACC Termites DAG
CF1 Forward Nucleus RAG1_exon3 Vertebrates GCCGCCAGATCTTCCAGCCCT Fishes NA
CO1aaF Forward Mitochondrion COI Malacology ATTCGGCCATTCTACCTGTG Lizard NA
CO1aaR Reverse Mitochondrion COI Malacology GCTAAYGGTGGGTAAACAGT Lizard NA
COIF Forward Mitochondrion COI Jemu GAACAGAACTTGGACAACA Termites DAG
COIIA-tLeumod Forward Mitochondrion COII Jemu CAGATAAGTGCATTGGATTT Termites DAG
COIIB-tLys Reverse Mitochondrion COII Jemu GTTTAAGAGACCAGTACTTG Termites DAG
CR1 Reverse Nucleus RAG1_intron2 Vertebrates AGGGCTGGAATATCTGGCGG Fishes NA
CR5 Reverse Nucleus RAG1_exon3 Vertebrates TGCGGGCGTAGTTTCCATTCA Fishes NA
CRaF Forward Mitochondrion Control_region Malacology CATCAATCACTACCCTCCATAATC Lizard NA
CRaR_ Reverse Mitochondrion Control_region Malacology GTAGGAGCACTTGAGATGAGGTC Lizard NA
CRbF Forward Mitochondrion Control_region Malacology TTACCCTCTTACCCTTGCTC Lizard NA
CRbR Reverse Mitochondrion Control_region Malacology TTTAGTTTCGTGTGATGAGCA Lizard NA
cytb-L14723 Forward Mitochondrion Cytb Jemu ACCAATGACATGAAAAATCATCGTT NA NA
H_CYTB Reverse Mitochondrion Cytochrome_b Vertebrates CAGGTGAGGATGGCGACG Fishes NA
H15149 Reverse Mitochondrion cob_cytb Vertebrates AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA mammals NA
H15149 Reverse Mitochondrion cob_cytb Vertebrates GCCCCTCAGAATGATATTTGTCCTCA mammals NA
H15915 Reverse Mitochondrion cob_cytb Vertebrates tctccatttctggtttacaagac mammals NA
KALIF1 Forward Nucleus RAG1_intron2 Vertebrates AAGGGTTTATGTTCAATCAA Fishes NA
L_ATP Forward NA ATP_synthase_6+8 Vertebrates TAGCGTTAGCCTTTTAAGCT Fishes NA
L_CYTB Forward Mitochondrion Cytochrome_b Vertebrates ACTAATGACTTGAAAAACCACC Fishes NA
LPRO2 Forward Mitochondrion Control_region Vertebrates CTCTCACCCCTAGCTCCCAAAG Fishes NA
LSU_F1 Forward Nucleus LSU Vertebrates AGCGGAGGAAAAGAAACTA Fishes NA
LSU_R1 Reverse Nucleus LSU Vertebrates TACTAGAAGGTTCGATTAGTC Fishes NA
Pan_270-291 NA Mitochondrion COI Jemu tatacgggggaatgccatgtcg Panidae BarPan
Pan_H172-193 Reverse Mitochondrion COI Jemu ttacgaacgcatgggctgtgac Panidae BarPan
Pan_L1-26 Forward Mitochondrion COI Jemu atgttcaccgaccgctgacta Panidae BarPan
Pan_L5-21 Forward Mitochondrion COI Jemu TCACCGACCGCTGACTATTCTC Panidae BarPan
R_ATP Reverse NA ATP_synthase_6+8 Vertebrates TATGCRTGTGCTTGMTGGGC Fishes NA
TDK-DH4-SHORT NA Mitochondrion Control_region Vertebrates GATCCCATCTTCAGTGTTATGC Fishes NA
28S-D1-CARHARP NA Nucleus 28S_rDNA Frederik_Hendrickx GGGAGGAAAAGAAACTAAC Harpalus NA
28S-D3-CARHARP NA Nucleus 28S_rDNA Frederik_Hendrickx GCATAGTTCACCATCTTTC Harpalus NA
3F Forward Nucleus 18Sa Frederik_Hendrickx GTTCGATTCCGGAGAGGGA none NA
9R Reverse Nucleus 18Sb Frederik_Hendrickx GATCCTTCCGCAGGTTCACCTAC none NA
A20 NA Nucleus 18Sb Frederik_Hendrickx ATGGTTGCAAAGCTGAAAC none NA
B1 NA Nucleus 18Sa Frederik_Hendrickx GAGTCTCGTTCGTTATCGGA none NA
C1J-1751 Forward Mitochondrion COI Frederik_Hendrickx GAGCTCCTGATATAGCTTTTCC none NA
C1N-2776 Reverse Mitochondrion COI Frederik_Hendrickx GGATAATCAGAATATCGTCGAGG none NA
H15915_Cytb Reverse Mitochondrion cob_cytb JEMU TCTCCATTTCTGGTTTACAAGAC Vertebrates DEMOTRORO
HCO2183R2 Reverse Mitochondrion COI Frederik_Hendrickx CCAAAAAATCAAAATARATGYTG spider_specific NA
HCO2198 Reverse Mitochondrion COI Frederik_Hendrickx TAAACTTCAGGGTGACCAAAAAATCA none NA
L14723_Cytb Forward Mitochondrion cob_cytb JEMU ACCAATGACATGAAAAATCATCGTT Vertebrates DEMOTRORO
L14724NAT Forward Mitochondrion cob_cytb JEMU GACCTGCGGTCCGAAAAACCA NA NA
LCO1490 Forward Mitochondrion COI Frederik_Hendrickx GGTCAACAAATCATAAAGATATTGG none NA
N1-J-12261 Forward NA NADH_1 Frederik_Hendrickx TCRTAAGAAATTATTTGAGC none NA
RICS741F Forward NA Rickettsia Frederik_Hendrickx CATCCGGAGCTAATGGTTTTGC NA NA
RICT1197R Reverse NA Rickettsia Frederik_Hendrickx CATTTCTTTCCATTGTGCCATC NA NA
Spits-J04 Forward NA Spiroplasma Frederik_Hendrickx GCCAGAAGTCAGTGTCCTAACCG NA NA
Spits-N55 Reverse NA Spiroplasma Frederik_Hendrickx ATTCCAAGGCATCCACCATACG NA NA
TL1-N-12718 Reverse NA NADH_1 Frederik_Hendrickx TGCATTAGAATTAGAATCTA none NA
Wsp691R-ant Reverse NA Wolbachia_WSP Frederik_Hendrickx AAAAATTAAACGCTACTCCA NA NA
Wsp691R-spider Reverse NA Wolbachia_WSP Frederik_Hendrickx AAAAATTAAACGCTACTCCAGCTTCTGCAC NA NA
wsp81F-ant Forward NA Wolbachia_WSP Frederik_Hendrickx TGGTCCAATAAGTGATGAAGAAAC ants NA
wsp81F-spider Forward NA Wolbachia_WSP Frederik_Hendrickx TGGTCCAATAAGTGATGAAGAAACTAGCTA NA NA
ZR2 NA Nucleus 28S_rDNA Frederik_Hendrickx GCTATCCTGAGGGAAACTTCGG 28S_short NA
ZR3 NA Nucleus 28S_rDNA Frederik_Hendrickx GAAAAGAACTTTGAAGAGAGAGTTCA 28S_short NA
16SA_Hym Reverse Mitochondrion 16S_rDNA JEMU TRACTGTRCAAAGGTAGC Hymenoptera Abia_Athalia
16SB_Hym Forward Mitochondrion 16S_rDNA JEMU TTAATTCAACATCGAGGTC Hymenoptera Abia_Athalia
16Souter Reverse Mitochondrion 16S_rDNA JEMU CTTATTCAACATCGAGGTC Hymenoptera Abia_Athalia
18Sr Reverse Nucleus 18S JEMU AGTTTTCCCGTGTTGAGTCA Diptera BC42W
28E Reverse Nucleus 28S JEMU CCTTATCCCGAAGTTACG Diptera BC42W
28H Reverse Nucleus 28S JEMU GGTTTCGCTGGATAGTAG Diptera BC42W
28K Reverse Nucleus 28S JEMU CTTCGATGTCGGCTCTTG Diptera BC42W
amelogenin_F Forward NA amelogenin JEMU CCCTGGGCTCTGTAAAGAATAGTG vertebrates/primates BarCoVer
amelogenin_R Reverse NA amelogenin JEMU ATCAGAGCTTAAACTGGGAAGCTG vertebrates/primates BarCoVer
F_C1-J-2183 Forward Mitochondrion COI JEMU CAACATTTATTTTGATTTTTTGG Diptera:calliphoridae BC42W
F_C1-J-2495 Forward Mitochondrion COI JEMU CAGCTACTTTATGAGCTTTAGG Diptera:calliphoridae BC42W
F_TY-J-1460 Forward Mitochondrion COI JEMU TACAATTTATCGCCTAAACTTCAGCC Diptera:calliphoridae BC42W
LR143F Forward Mitochondrion long-wavelength_rhodopsin JEMU GACAAAGTKCCACCRGARATGCT ant ANDANT
LR639ER Reverse Mitochondrion long-wavelength_rhodopsin JEMU YTTACCGRTTCCATCCRAACA ant ANDANT
Mut-R299 Reverse Mitochondrion COI JEMU TAATTGCNCCAGCTAAAACTGGTA Mutillidae NA
Mut-R301 Reverse Mitochondrion COI JEMU GTAATTGCNCCAGCTAAAACTG Mutillidae NA
R_C1-N-2191 Reverse Mitochondrion COI JEMU CCCGGTAAAATTAAAATATAAACTTC Diptera:calliphoridae BC42W
R_C1-N-2293a Reverse Mitochondrion COI JEMU AGTAAACCAATTGCTAGTATAGC Diptera:calliphoridae BC42W
R_C1-N-2659 Reverse Mitochondrion COI JEMU GCTAATCCAGTGAATAATGG Diptera:calliphoridae BC42W
R_TL2-N-3013 Reverse Mitochondrion COI JEMU TCCATTACATATAATCTGCCATATTAG Diptera:calliphoridae BC42W
rc28D Forward Nucleus 28S JEMU CCGCAGCTGGTCTCCAAG Diptera BC42W
rc28H Forward Nucleus 28S JEMU CTACTATCCAGCGAAACC Diptera BC42W
rc28p Forward Nucleus 28S JEMU TGGTATGCGTAGAAGTGTTTGGC Diptera BC42W
Uni-MinibarF1-d Forward Mitochondrion COI JEMU TCYACTAATCATAAAGATATTGGYAC Sarcophaga BC42W-NICC
Uni-MinibarR1-d Reverse Mitochondrion COI JEMU AAAATTATAATAAARGCRTGRGC Sarcophaga BC42W-NICC
Wg1032R Reverse Mitochondrion Wingless JEMU ACYTCGCAGCACCARTGGAA ant ANDANT
16SA Reverse Mitochondrion 16S Zoltan Nagy CGCCTGTTTATCAAAAACAT NA ZTN
16Sbr Forward Mitochondrion 16S Zoltan Nagy CCGGTYTGAACTCAGATCAYGT NA ZTN
aBelcan_10895_F Forward Mitochondrion ND4 JEMU ACTTGCCGCTGTACTCCTA canids Synthesis O Thalmann with M Germonpre
aBelcan_13594_F Forward Mitochondrion ND6 JEMU CCACGGGTAACTTCCATGAT canids Synthesis O Thalmann with M Germonpre
aBelcan_13706_R Reverse Mitochondrion ND6 JEMU AGTGAAGAGGCTATGGGTATTG canids Synthesis O Thalmann with M Germonpre
aBelcan_4293_F Forward Mitochondrion ND2 JEMU CAGGAATAATCCTACTAACATGACAA canids Synthesis O Thalmann with M Germonpre
aBelcan_6218_F Forward Mitochondrion COI JEMU TCACCATATGTTTACCGTAGGA canids Synthesis O Thalmann with M Germonpre
aBelcan_8485_F Forward Mitochondrion ATPase subunit 6 JEMU GATTGGAGGGGCTACCTTAG canids Synthesis O Thalmann with M Germonpre
BatL5310 Forward Mitochondrion COI JEMU CCTACTCRGCCATTTTACCTATG rodent Demotroro
CR2bR Reverse Mitochondrion Control Region JEMU_RBINS CCGGAGCGAGAAGAGGTACA Lynx DNA-ID
Farrell_cobR Reverse Mitochondrion cytb JEMU_RBINS TATTCT TTATCTGCCTATACATRCACG Carnivora DNA-ID
KIAA1239F1 Forward Nucleus KIAA1239 JEMU_RBINS CARCCTTGGGTNTTYCARTGYAA Universal nuclear protein-coding locus (NPCL)
KIAA1239F2 Forward Nucleus KIAA1243 JEMU_RBINS GAYGARAARTACYTNGTNGT Universal nuclear protein-coding locus (NPCL)
KIAA1239NF1 Forward Nucleus KIAA1241 JEMU_RBINS GAGCCNGAYATHTTYTTYGTNAA Universal nuclear protein-coding locus (NPCL)
KIAA1239NF2 Forward Nucleus KIAA1245 JEMU_RBINS TTCCAYTGCTGGTAYGARGTNAC Universal nuclear protein-coding locus (NPCL)
KIAA1239NR1 Reverse Nucleus KIAA1242 JEMU_RBINS TTCACRAANCCMCCNGAAAAYTC Universal nuclear protein-coding locus (NPCL)
KIAA1239R1 Reverse Nucleus KIAA1246 JEMU_RBINS ACMACAAAYTGGTCRTTRTGNGT Universal nuclear protein-coding locus (NPCL)
KIAA1239R1 Reverse Nucleus KIAA1240 JEMU_RBINS ACMACAAAYTGGTCRTTRTGNGT Universal nuclear protein-coding locus (NPCL)
KIAA1239R2 Reverse Nucleus KIAA1244 JEMU_RBINS TCYTCNAGRTTYTTNARRAARTT Universal nuclear protein-coding locus (NPCL)
R6036R Reverse Mitochondrion COI JEMU ACTTCTGGGTGTCCAAAGAATCA rodent Demotroro
SACSF1 Forward Nucleus SACS JEMU_RBINS AARGARATHTGGAARACNGAYAC Universal nuclear protein-coding locus (NPCL)
SACSF2 Forward Nucleus SACS JEMU_RBINS AAYATHACNAAYGCNTGYTAYAA Universal nuclear protein-coding locus (NPCL)
SACSNF1 Forward Nucleus SACS JEMU_RBINS CAYCCYGAAGGAMGNGTNGCNAA Universal nuclear protein-coding locus (NPCL)
SACSNF2 Forward Nucleus SACS JEMU_RBINS TGYTAYAAYGAYTGYCCNTGGAT Universal nuclear protein-coding locus (NPCL)
SACSNR1 Reverse Nucleus SACS JEMU_RBINS GCWACYTCYCKNGGDATRTC Universal nuclear protein-coding locus (NPCL)
SACSNR2 Reverse Nucleus SACS JEMU_RBINS CKGTGRGGYTTYTTRTARTTRTG Universal nuclear protein-coding locus (NPCL)
SACSR1 Reverse Nucleus SACS JEMU_RBINS GCYTTNGCRTCRTCNGCRTTYTG Universal nuclear protein-coding locus (NPCL)
SACSR2 Reverse Nucleus SACS JEMU_RBINS GCRAARTGNCCRTTNACRTGRAA Universal nuclear protein-coding locus (NPCL)
TTNF1 Forward Nucleus TTN JEMU_RBINS TATGCTGARAAYATNGCNGGNAT Universal nuclear protein-coding locus (NPCL)
TTNF2 Forward Nucleus TTN JEMU_RBINS TAYATYGTNGARAARCGNGARAC Universal nuclear protein-coding locus (NPCL)
TTNNF1 Forward Nucleus TTN JEMU_RBINS GATGGNMGKTGGYTNAARTGYAA Universal nuclear protein-coding locus (NPCL)
TTNNF2 Forward Nucleus TTN JEMU_RBINS GGYAAYGARTAYRTHTTYAGRGT Universal nuclear protein-coding locus (NPCL)
TTNNR1 Reverse Nucleus TTN JEMU_RBINS AGRTCRTANACNGGYTTYTTRTT Universal nuclear protein-coding locus (NPCL)
TTNNR2 Reverse Nucleus TTN JEMU_RBINS GCWCCWCCNTCRTTNTCNGG Universal nuclear protein-coding locus (NPCL)
TTNR1 Reverse Nucleus TTN JEMU_RBINS CCMCCRTCAAAYARNGGYTT Universal nuclear protein-coding locus (NPCL)
TTNR2 Reverse Nucleus TTN JEMU_RBINS TCRCCWGWNACYCTRAARTARTA Universal nuclear protein-coding locus (NPCL)
16Sf.dip Forward Mitochondrion 16S JEMU CGCCTGTTTAACAAAAACAT Diptera BC42W
16Sr.dip Reverse Mitochondrion 16S JEMU TGAACTCAGATCATGTAAGAAA Diptera BC42W
aBelcan_11024_R Reverse Mitochondrion ND4 JEMU GCTTGTTATGATTATGCCTCA canids Synthesis O Thalmann with M Germonpre
aBelcan_4433_R Reverse Mitochondrion ND2 JEMU TTTGATTTAGTCCGCCTCAG canids Synthesis O Thalmann with M Germonpre
aBelcan_6307_R Reverse Mitochondrion COI JEMU TTTACTCCCGTTGGAATAGC canids Synthesis O Thalmann with M Germonpre
aBelcan_8613_R Reverse Mitochondrion ATPase subunit 6 JEMU AAGGTAAAAACATAGGCTTGAA canids Synthesis O Thalmann with M Germonpre
ApCADfor4 Forward Nucleus CAD JEMU TGGAARGARGTBGARTACGARGTGGTYCG Bees incl. Halictinae Halictus
ArgKfor2 Forward Nucleus ArgK arginine kinase JEMU GACAGCAARTCTCTGCTGAAGAA corbiculate Apinae Halictus
ArgKrev2 Reverse Nucleus ArgK arginine kinase JEMU GGTYTTGGCATCGTTGTGGTAGATAC corbiculate Apinae Halictus
Darw1-F Forward Mitochondrion COI Karin Breugelmans ATGTTGTAGTGACTGCTCAT Darwinitium Ganesella
Darw2-F Forward Mitochondrion COI Karin Breugelmans ATAATTGGGGGRTTTGGGAATTG Darwinitium – Ganesella
Darw3-F Forward Mitochondrion COI Karin Breugelmans TCTCCTCYATTCTTGGGGCAAT Darwinitium – Ganesella
Darw4-F Forward Mitochondrion COI Karin Breugelmans GGAATAACTATAGAACGAGTAAGA Darwinitium – Ganesella
Darw5-R Reverse Mitochondrion COI Karin Breugelmans GGNGGATAAACAGTYCACCCAGT Darwinitium – Ganesella
dNKf1 Forward Nucleus Dnk deoxyribonucleoside kinase JEMU GARGGYAAYATMGGHAGCGGKAARAC corbiculate Apinae Halictus
dNKr1 Reverse Nucleus Dnk deoxyribonucleoside kinase JEMU AGCCAKTCMTCRTGMATMTTRTGMAGYT corbiculate Apinae Halictus
EF-F06t Reverse Nucleus Elongation factor JEMU_Tervuren CAGGAAACAGCTATGACTTACCTTCAGCGTTACCTTC Diptera BC42W_NICC
HOG3683_01_F Forward Nucleus HOG3683_01 JEMU GCYATYTTCGAYTTYGAYAG Hymenoptera Halictus
HOG3683_01_R Reverse Nucleus HOG3683_01 JEMU AAVGTRAAKGATTCGTTGTA Hymenoptera Halictus
HOG4652_10_F Forward Nucleus HOG4652_10 JEMU GGWTTTGGYTTTATTCGTTG Hymenoptera Halictus
HOG4652_10_R Reverse Nucleus HOG4652_10 JEMU YTCTTTATTYCGYTTYACTTG Hymenoptera Halictus
HOG7036_02__F Forward Nucleus HOG7036_02 JEMU TTTGTCWGYGKGTGCCTTGT Hymenoptera Halictus
HOG7036_02__R Reverse Nucleus HOG7036_02 JEMU TTCATRGTWGCTTCRGTATCNGT Hymenoptera Halictus
HOG7229_02_F Forward Nucleus HOG7229_02 JEMU TGCYTGATHCTSTTCTTCGT Hymenoptera Halictus
HOG7229_02_R Reverse Nucleus HOG7229_02 JEMU TRTGRAAYCTRTGRAAGATGCA Hymenoptera Halictus
ITS2 Forward Nucleus ITS JEMU GCTGCGTTCTTCATCGATGC Apidae (Meliponini) Halictus
ITS5 Reverse Nucleus ITS JEMU GCAAGTAAAAGTCGTAACAAGG Apidae (Meliponini) Halictus
NaKfor2 Forward Nucleus NaK JEMU GCSTTCTTCTCBACSAACGCCGTYGARGG corbiculate Apinae Halictus
NaKrev2 Reverse Nucleus NaK JEMU ACCTTGATRCCGGCYGAWCGGCACTTGGC corbiculate Apinae Halictus
whitefor2 Forward Nucleus white gene JEMU GCTGARGGWAGAGTAGCYTTCATGGG corbiculate Apinae Halictus
whiterev2 Reverse Nucleus white gene JEMU CSGCRAARACGTTCTGGAARGTCATATT corbiculate Apinae Halictus
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith