Primer database

Direction Genome Marker name Owner Sequence Specificity project name
Darw5-R Reverse Mitochondrion COI Karin Breugelmans GGNGGATAAACAGTYCACCCAGT Darwinitium – Ganesella
Darw4-F Forward Mitochondrion COI Karin Breugelmans GGAATAACTATAGAACGAGTAAGA Darwinitium – Ganesella
Darw3-F Forward Mitochondrion COI Karin Breugelmans TCTCCTCYATTCTTGGGGCAAT Darwinitium – Ganesella
Darw2-F Forward Mitochondrion COI Karin Breugelmans ATAATTGGGGGRTTTGGGAATTG Darwinitium – Ganesella
Darw1-F Forward Mitochondrion COI Karin Breugelmans ATGTTGTAGTGACTGCTCAT Darwinitium Ganesella
ApCADfor4 Forward Nucleus CAD JEMU TGGAARGARGTBGARTACGARGTGGTYCG Bees incl. Halictinae Halictus
ApCADrev4a Reverse Nucleus CAD JEMU GGCCAYTGNGCNGCCACYGTGTCTATYTGYTTNACC Bees incl. Halictinae Halictus
ArgKfor2 Forward Nucleus ArgK arginine kinase JEMU GACAGCAARTCTCTGCTGAAGAA corbiculate Apinae Halictus
ArgKrev2 Reverse Nucleus ArgK arginine kinase JEMU GGTYTTGGCATCGTTGTGGTAGATAC corbiculate Apinae Halictus
dNKf1 Forward Nucleus Dnk deoxyribonucleoside kinase JEMU GARGGYAAYATMGGHAGCGGKAARAC corbiculate Apinae Halictus
dNKr1 Reverse Nucleus Dnk deoxyribonucleoside kinase JEMU AGCCAKTCMTCRTGMATMTTRTGMAGYT corbiculate Apinae Halictus
HOG3683_01_F Forward Nucleus HOG3683_01 JEMU GCYATYTTCGAYTTYGAYAG Hymenoptera Halictus
HOG3683_01_R Reverse Nucleus HOG3683_01 JEMU AAVGTRAAKGATTCGTTGTA Hymenoptera Halictus
HOG4652_10_F Forward Nucleus HOG4652_10 JEMU GGWTTTGGYTTTATTCGTTG Hymenoptera Halictus
HOG4652_10_R Reverse Nucleus HOG4652_10 JEMU YTCTTTATTYCGYTTYACTTG Hymenoptera Halictus
HOG7036_02__F Forward Nucleus HOG7036_02 JEMU TTTGTCWGYGKGTGCCTTGT Hymenoptera Halictus
HOG7036_02__R Reverse Nucleus HOG7036_02 JEMU TTCATRGTWGCTTCRGTATCNGT Hymenoptera Halictus
HOG7229_02_F Forward Nucleus HOG7229_02 JEMU TGCYTGATHCTSTTCTTCGT Hymenoptera Halictus
HOG7229_02_R Reverse Nucleus HOG7229_02 JEMU TRTGRAAYCTRTGRAAGATGCA Hymenoptera Halictus
ITS2 Forward Nucleus ITS JEMU GCTGCGTTCTTCATCGATGC Apidae (Meliponini) Halictus
ITS5 Reverse Nucleus ITS JEMU GCAAGTAAAAGTCGTAACAAGG Apidae (Meliponini) Halictus
NaKfor2 Forward Nucleus NaK JEMU GCSTTCTTCTCBACSAACGCCGTYGARGG corbiculate Apinae Halictus
NaKrev2 Reverse Nucleus NaK JEMU ACCTTGATRCCGGCYGAWCGGCACTTGGC corbiculate Apinae Halictus
whitefor2 Forward Nucleus white gene JEMU GCTGARGGWAGAGTAGCYTTCATGGG corbiculate Apinae Halictus
whiterev2 Reverse Nucleus white gene JEMU CSGCRAARACGTTCTGGAARGTCATATT corbiculate Apinae Halictus
16Sr.dip Reverse Mitochondrion 16S JEMU TGAACTCAGATCATGTAAGAAA Diptera BC42W
16Sf.dip Forward Mitochondrion 16S JEMU CGCCTGTTTAACAAAAACAT Diptera BC42W
CB4F Forward Mitochondrion cytb JEMU_RBINS ACATACATGCCAACGGG Lynx DNA-ID
CB6R Reverse Mitochondrion cytb JEMU_RBINS GTGGCTATAACTGTAAATAGTAATAG Lynx DNA-ID
CB7R Reverse Mitochondrion cytb JEMU_RBINS TGGTAGGACATATCCTATGAAG Lynx DNA-ID
CR2bR Reverse Mitochondrion Control Region JEMU_RBINS CCGGAGCGAGAAGAGGTACA Lynx DNA-ID
DL7F Forward Mitochondrion D-loop JEMU_RBINS CTTAATCGTGCATTATACCTTGT Lynx DNA-ID
Farrell_cobF Forward Mitochondrion cytb JEMU_RBINS AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA Carnivora DNA-ID
Farrell_cobR Reverse Mitochondrion cytb JEMU_RBINS TATTCT TTATCTGCCTATACATRCACG Carnivora DNA-ID
KIAA1239F1 Forward Nucleus KIAA1239 JEMU_RBINS CARCCTTGGGTNTTYCARTGYAA Universal nuclear protein-coding locus (NPCL)
KIAA1239F2 Forward Nucleus KIAA1243 JEMU_RBINS GAYGARAARTACYTNGTNGT Universal nuclear protein-coding locus (NPCL)
KIAA1239NF1 Forward Nucleus KIAA1241 JEMU_RBINS GAGCCNGAYATHTTYTTYGTNAA Universal nuclear protein-coding locus (NPCL)
KIAA1239NF2 Forward Nucleus KIAA1245 JEMU_RBINS TTCCAYTGCTGGTAYGARGTNAC Universal nuclear protein-coding locus (NPCL)
KIAA1239NR1 Reverse Nucleus KIAA1242 JEMU_RBINS TTCACRAANCCMCCNGAAAAYTC Universal nuclear protein-coding locus (NPCL)
KIAA1239R1 Reverse Nucleus KIAA1240 JEMU_RBINS ACMACAAAYTGGTCRTTRTGNGT Universal nuclear protein-coding locus (NPCL)
KIAA1239R1 Reverse Nucleus KIAA1246 JEMU_RBINS ACMACAAAYTGGTCRTTRTGNGT Universal nuclear protein-coding locus (NPCL)
KIAA1239R2 Reverse Nucleus KIAA1244 JEMU_RBINS TCYTCNAGRTTYTTNARRAARTT Universal nuclear protein-coding locus (NPCL)
SACSF1 Forward Nucleus SACS JEMU_RBINS AARGARATHTGGAARACNGAYAC Universal nuclear protein-coding locus (NPCL)
SACSF2 Forward Nucleus SACS JEMU_RBINS AAYATHACNAAYGCNTGYTAYAA Universal nuclear protein-coding locus (NPCL)
SACSNF1 Forward Nucleus SACS JEMU_RBINS CAYCCYGAAGGAMGNGTNGCNAA Universal nuclear protein-coding locus (NPCL)
SACSNF2 Forward Nucleus SACS JEMU_RBINS TGYTAYAAYGAYTGYCCNTGGAT Universal nuclear protein-coding locus (NPCL)
SACSNR1 Reverse Nucleus SACS JEMU_RBINS GCWACYTCYCKNGGDATRTC Universal nuclear protein-coding locus (NPCL)
SACSNR2 Reverse Nucleus SACS JEMU_RBINS CKGTGRGGYTTYTTRTARTTRTG Universal nuclear protein-coding locus (NPCL)
SACSR1 Reverse Nucleus SACS JEMU_RBINS GCYTTNGCRTCRTCNGCRTTYTG Universal nuclear protein-coding locus (NPCL)
SACSR2 Reverse Nucleus SACS JEMU_RBINS GCRAARTGNCCRTTNACRTGRAA Universal nuclear protein-coding locus (NPCL)
TTNF1 Forward Nucleus TTN JEMU_RBINS TATGCTGARAAYATNGCNGGNAT Universal nuclear protein-coding locus (NPCL)
TTNF2 Forward Nucleus TTN JEMU_RBINS TAYATYGTNGARAARCGNGARAC Universal nuclear protein-coding locus (NPCL)
TTNNF1 Forward Nucleus TTN JEMU_RBINS GATGGNMGKTGGYTNAARTGYAA Universal nuclear protein-coding locus (NPCL)
TTNNF2 Forward Nucleus TTN JEMU_RBINS GGYAAYGARTAYRTHTTYAGRGT Universal nuclear protein-coding locus (NPCL)
TTNNR1 Reverse Nucleus TTN JEMU_RBINS AGRTCRTANACNGGYTTYTTRTT Universal nuclear protein-coding locus (NPCL)
TTNNR2 Reverse Nucleus TTN JEMU_RBINS GCWCCWCCNTCRTTNTCNGG Universal nuclear protein-coding locus (NPCL)
TTNR1 Reverse Nucleus TTN JEMU_RBINS CCMCCRTCAAAYARNGGYTT Universal nuclear protein-coding locus (NPCL)
TTNR2 Reverse Nucleus TTN JEMU_RBINS TCRCCWGWNACYCTRAARTARTA Universal nuclear protein-coding locus (NPCL)
DL1F Forward Mitochondrion D-loop JEMU_RBINS TTGCCCAGTATGTCTTCACC Lynx DNA-ID
DL5R Reverse Mitochondrion D-loop JEMU_RBINS TACATGCTTAATATTCATGGGATT Lynx DNA-ID
ITS2R.dip-t Reverse Nucleus ITS2 JEMU CAGGAAACAGCTATGACGTAGTCCCATATGAGTTGAGGTT Diptera BC42W
ITS2F.dip-t Forward Nucleus ITS2 JEMU TGTAAAACGACGGCCAGTTGCTTGGACTACATATGGTTGA Diptera BC42W
D1.Ft Forward Nucleus 28S Jemu_Tervuren TGTAAAACGACGGCCAGTCCCCCTGAATTTAAGCATAT Diptera BC42W
D2.Rt Reverse Nucleus 28S Jemu_Tervuren CAGGAAACAGCTATGACGTTAGACTCCTTGGTCCGTG Diptera BC42W
C2-J-3138t Forward Mitochondrion COII Jemu_Tervuren TGTAAAACGACGGCCAGTAGAGCCTCTCCTTTAATAGAACA Diptera BC42W
TK-N-3775t Reverse Mitochondrion COII Jemu_Tervuren CAGGAAACAGCTATGACGAGACCATTACTTGCTTTCAGTCATCT Diptera BC42W
16Sbr Forward Mitochondrion 16S Zoltan Nagy CCGGTYTGAACTCAGATCAYGT NA ZTN
16SA Reverse Mitochondrion 16S Zoltan Nagy CGCCTGTTTATCAAAAACAT NA ZTN
BatL5310 Forward Mitochondrion COI JEMU CCTACTCRGCCATTTTACCTATG rodent Demotroro
R6036R Reverse Mitochondrion COI JEMU ACTTCTGGGTGTCCAAAGAATCA rodent Demotroro
M13_Pgd_4R Reverse Mitochondrion PGD JEMU CAGGAAACAGCTATGACCCNGTCCARTTNGTRTG diptera BC42W-biodiv
Uni-MinibarF1-d Forward Mitochondrion COI JEMU TCYACTAATCATAAAGATATTGGYAC Sarcophaga BC42W-NICC
Uni-MinibarR1-d Reverse Mitochondrion COI JEMU AAAATTATAATAAARGCRTGRGC Sarcophaga BC42W-NICC
M13_Pgd_2F Forward Mitochondrion PGD JEMU AAAACGACGGCCAGTGATATHGARTAYGGNGAYATGCA diptera BC42W-biodiv
M13_Pgd_3R Reverse Mitochondrion PGD JEMU CAGGAAACAGCTATGACGTRTGIGCNCCRAARTARTC diptera BC42W-biodiv
16Souter Reverse Mitochondrion 16S_rDNA JEMU CTTATTCAACATCGAGGTC Hymenoptera Abia_Athalia
16SA_Hym Forward Mitochondrion 16S_rDNA JEMU TRACTGTRCAAAGGTAGC Hymenoptera Abia_Athalia
16SB_Hym Reverse Mitochondrion 16S_rDNA JEMU TTAATTCAACATCGAGGTC Hymenoptera Abia_Athalia
LR143F Forward Mitochondrion long-wavelength_rhodopsin JEMU GACAAAGTKCCACCRGARATGCT ant ANDANT
LR639ER Reverse Mitochondrion long-wavelength_rhodopsin JEMU YTTACCGRTTCCATCCRAACA ant ANDANT
Wg1032R Reverse Mitochondrion Wingless JEMU ACYTCGCAGCACCARTGGAA ant ANDANT
Wg578F Forward Mitochondrion Wingless JEMU TGCACNGTGAARACYTGCTGGATGCG ant ANDANT
28Z Reverse Nucleus 28S JEMU GCAAAGGATAAGCTTCGATGG Diptera BC42W
EF4 Forward Nucleus EF JEMU GARGGTGGTATYACMATTGA Diptera BC42W
EF5 Reverse Nucleus EF JEMU CTCATATCACGTACAGCRAARGG Diptera BC42W
rc28Q Forward Nucleus 28S JEMU GGACATTGCCAGGTAGGGAGTT Diptera BC42W
28K Reverse Nucleus 28S JEMU CTTCGATGTCGGCTCTTG Diptera BC42W
rc28H Forward Nucleus 28S JEMU CTACTATCCAGCGAAACC Diptera BC42W
28E Reverse Nucleus 28S JEMU CCTTATCCCGAAGTTACG Diptera BC42W
28H Reverse Nucleus 28S JEMU GGTTTCGCTGGATAGTAG Diptera BC42W
rc28D Forward Nucleus 28S JEMU CCGCAGCTGGTCTCCAAG Diptera BC42W
18Sr Reverse Nucleus 18S JEMU AGTTTTCCCGTGTTGAGTCA Diptera BC42W
rc28p Forward Nucleus 28S JEMU TGGTATGCGTAGAAGTGTTTGGC Diptera BC42W
18SF Forward Nucleus 18S JEMU CATATCCGAGGCCCTGTAAT Diptera BC42W
F_C1-J-2183 Forward Mitochondrion COI JEMU CAACATTTATTTTGATTTTTTGG Diptera:calliphoridae BC42W
F_C1-J-2495 Forward Mitochondrion COI JEMU CAGCTACTTTATGAGCTTTAGG Diptera:calliphoridae BC42W
R_C1-N-2293a Reverse Mitochondrion COI JEMU AGTAAACCAATTGCTAGTATAGC Diptera:calliphoridae BC42W
R_C1-N-2659 Reverse Mitochondrion COI JEMU GCTAATCCAGTGAATAATGG Diptera:calliphoridae BC42W
R_TL2-N-3013 Reverse Mitochondrion COI JEMU TCCATTACATATAATCTGCCATATTAG Diptera:calliphoridae BC42W
F_TY-J-1460 Forward Mitochondrion COI JEMU TACAATTTATCGCCTAAACTTCAGCC Diptera:calliphoridae BC42W
H689 Reverse NA NA JEMU TAAWTAWTATRATTACTCCTA Rodents DEMOTRORO
H740 Reverse NA NA JEMU GTAGTTGTCKGGRTCTCCTA Rodents DEMOTRORO
L348 Forward NA NA JEMU TTYATAGAAACATGAAACATYGGA Rodents DEMOTRORO
L671 Forward NA NA JEMU TTCCATTTCACCCATACTA Rodents DEMOTRORO
Mut-R299 Reverse Mitochondrion COI JEMU TAATTGCNCCAGCTAAAACTGGTA Mutillidae NA
Mut-R301 Reverse Mitochondrion COI JEMU GTAATTGCNCCAGCTAAAACTG Mutillidae NA
R_C1-N-2191 Reverse Mitochondrion COI JEMU CCCGGTAAAATTAAAATATAAACTTC Diptera:calliphoridae BC42W
amelogenin_F Forward NA amelogenin JEMU CCCTGGGCTCTGTAAAGAATAGTG vertebrates/primates BarCoVer
amelogenin_R Reverse NA amelogenin JEMU ATCAGAGCTTAAACTGGGAAGCTG vertebrates/primates BarCoVer
H1046 Reverse NA NA JEMU TAAATGGGTCTTCTACTGG NA NA
LEU-1 NA NA NA NA CATTACTTTTACTTGGATTTGCACCA NA NA
LO Forward NA NA JEMU ATGGCCCCTGTTTTACGCAA NA NA
ND4-1 NA NA NA NA CACCTATGACTACCAAAAGCTCATGTAGAAGC NA NA
NT3-F3 Forward NA NA NA ATATTTCTGGCTTTTCTCTGTGGC NA NA
NT3-R4 NA NA NA NA GCGTTTCATAAAAATATTGTTTGACC NA NA
AmpF1 Forward NA NA JEMU ACAGGATATGATGARAAGCTTGT NA NA
C1F0 Forward Mitochondrion COI JEMU ATTTTGATTCTTTGGTCACC Termites DAG
C1R1 Reverse Mitochondrion COI JEMU ATGAATARRAAYATTATTACTC Termites DAG
C1R1GLO Reverse NA NA JEMU ATGAATAGGAATAGTATAACTC Termites DAG
C1R1SAT Reverse NA NA JEMU ATAAAAATAAATATTATGACTC Termites DAG
C2F2 Forward Mitochondrion COII JEMU ATACCTCGACGWTATTCAGA Termites DAG
cytb-H14723 Reverse NA NA NA ACCAATGACATGAAAAATCATCGTT NA NA
tLysR Reverse Mitochondrion COII JEMU GTTTAAGAGACCAGTACTTG Termites DAG
AmpR1 Reverse NA NA JEMU AACTCAGCTGCATTKCCAATRTCA NA NA
M461 NA NA NA JEMU CAGGAAACAGCTATGACGAGGAAATYAARAAGGAAG NA NA
M519 NA NA NA JEMU CAGGAAACAGCTATGACCARGACGTATACAAAATCGG NA NA
M527 NA NA NA JEMU CAGGAAACAGCTATGACGTCAAGGARYTGCGTCGTGG NA NA
RAG1_UCF Forward NA NA JEMU GGGMGGCAGATCTTYCAGCC NA NA
RAG1_UCR Reverse NA NA JEMU TTGGACTGCCTGGCATTCAT NA NA
rcM4 NA NA NA JEMU TGTAAAACGACGGCCAGTACAGCVACKGTYTGYCTCATRTC NA NA
rcM526 NA NA NA JEMU TGTAAAACGACGGCCAGTGCYTCGTGGTGCATYTCSAC NA NA
rcM532 NA NA NA JEMU TGTAAAACGACGGCCAGTGCAATGTGRGCIGTGTGGCA NA NA
C_ANTMR1D-AMR1deg_R Reverse Mitochondrion COI JEMU CAWCCWGTWCCKRMNCCWKCAT NA NA
H15915_Cytb Reverse Mitochondrion cob_cytb JEMU TCTCCATTTCTGGTTTACAAGAC Vertebrates DEMOTRORO
H16064 Reverse NA NA JEMU CTTTGGTTTACAAGAACAATGCTTTA NA NA
L14723_Cytb Forward Mitochondrion cob_cytb JEMU ACCAATGACATGAAAAATCATCGTT Vertebrates DEMOTRORO
L14724NAT Forward Mitochondrion cob_cytb JEMU GACCTGCGGTCCGAAAAACCA NA NA
L15444 Forward NA NA JEMU CCAACCTTAACACGATTCTTTGCC NA NA
M3 NA NA NA JEMU CAGGAAACAGCTATGACCACATYAACATTGTCGTSATYGG NA NA
M441 NA NA NA JEMU CAGGAAACAGCTATGACGCTGAGCGYGARCGTGGTATCAC NA NA
rcM449 NA NA NA JEMU TGTAAAACGACGGCCAGTCTTGATGAAATCYCTGTGTCC NA NA
rcM511 NA NA NA JEMU TGTAAAACGACGGCCAGTCATRTTGTCKCCGTGCCAKCC NA NA
C_ANTMR1D-RonIIdeg_R Reverse Mitochondrion COI JEMU GGRGGRTARAYAGTTCATCCWGTWCC NA NA
LF1 Forward Mitochondrion COI JEMU ATTCAACCAATCATAAAGATATTGG NA NA
LR1 Reverse Mitochondrion COI JEMU TAAACTTCTGGATGTCCAAAAAATCA NA NA
MLepF1 Forward Mitochondrion COI JEMU GCTTTCCCACGAATAAATAATA NA NA
Wsp691R-ant Reverse NA Wolbachia_WSP Frederik_Hendrickx AAAAATTAAACGCTACTCCA NA NA
Wsp691R-spider Reverse NA Wolbachia_WSP Frederik_Hendrickx AAAAATTAAACGCTACTCCAGCTTCTGCAC NA NA
wsp81F-ant Forward NA Wolbachia_WSP Frederik_Hendrickx TGGTCCAATAAGTGATGAAGAAAC ants NA
wsp81F-spider Forward NA Wolbachia_WSP Frederik_Hendrickx TGGTCCAATAAGTGATGAAGAAACTAGCTA NA NA
ZR2 NA Nucleus 28S_rDNA Frederik_Hendrickx GCTATCCTGAGGGAAACTTCGG 28S_short NA
ZR3 NA Nucleus 28S_rDNA Frederik_Hendrickx GAAAAGAACTTTGAAGAGAGAGTTCA 28S_short NA
HCO2183R2 Reverse Mitochondrion COI Frederik_Hendrickx CCAAAAAATCAAAATARATGYTG spider_specific NA
HCO2198 Reverse Mitochondrion COI Frederik_Hendrickx TAAACTTCAGGGTGACCAAAAAATCA none NA
LCO1490 Forward Mitochondrion COI Frederik_Hendrickx GGTCAACAAATCATAAAGATATTGG none NA
N1-J-12261 Forward NA NADH_1 Frederik_Hendrickx TCRTAAGAAATTATTTGAGC none NA
RICS741F Forward NA Rickettsia Frederik_Hendrickx CATCCGGAGCTAATGGTTTTGC NA NA
RICT1197R Reverse NA Rickettsia Frederik_Hendrickx CATTTCTTTCCATTGTGCCATC NA NA
Spits-J04 Forward NA Spiroplasma Frederik_Hendrickx GCCAGAAGTCAGTGTCCTAACCG NA NA
Spits-N55 Reverse NA Spiroplasma Frederik_Hendrickx ATTCCAAGGCATCCACCATACG NA NA
TL1-N-12718 Reverse NA NADH_1 Frederik_Hendrickx TGCATTAGAATTAGAATCTA none NA
28S-D1-CARHARP NA Nucleus 28S_rDNA Frederik_Hendrickx GGGAGGAAAAGAAACTAAC Harpalus NA
28S-D3-CARHARP NA Nucleus 28S_rDNA Frederik_Hendrickx GCATAGTTCACCATCTTTC Harpalus NA
28Sb-CARPLAT NA Nucleus 28S_rDNA Frederik_Hendrickx TCGGAAGGAACCAGCTACTA Platynini_(Carabidae) NA
3F Forward Nucleus 18Sa Frederik_Hendrickx GTTCGATTCCGGAGAGGGA none NA
9R Reverse Nucleus 18Sb Frederik_Hendrickx GATCCTTCCGCAGGTTCACCTAC none NA
A20 NA Nucleus 18Sb Frederik_Hendrickx ATGGTTGCAAAGCTGAAAC none NA
B1 NA Nucleus 18Sa Frederik_Hendrickx GAGTCTCGTTCGTTATCGGA none NA
C1J-1751 Forward Mitochondrion COI Frederik_Hendrickx GAGCTCCTGATATAGCTTTTCC none NA
C1N-2776 Reverse Mitochondrion COI Frederik_Hendrickx GGATAATCAGAATATCGTCGAGG none NA
28S_rD5a-CARPLAT Reverse Nucleus 28S_rDNA Frederik_Hendrickx GGYGTTGGTTGCTTAAGACAG Platynini_(Carabidae) NA
28S_rD6b-CARPLAT Reverse Nucleus 28S_rDNA Frederik_Hendrickx AACCRGATTCCCTTTCGCC Platynini_(Carabidae) NA
28Sa-CARPLAT NA Nucleus 28S_rDNA Frederik_Hendrickx GACCCGTCTTGAAACACGGA Platynini_(Carabidae) NA
COIR Reverse Mitochondrion COI Jemu CTACTGTGAATATRTGRTGTGC Termites DAG
H15149 Reverse Mitochondrion cob_cytb Vertebrates GCCCCTCAGAATGATATTTGTCCTCA mammals NA
H15149 Reverse Mitochondrion cob_cytb Vertebrates AAACTGCAGCCCCTCAGAATGATATTTGTCCTCA mammals NA
H15915 Reverse Mitochondrion cob_cytb Vertebrates tctccatttctggtttacaagac mammals NA
12Sr Reverse Mitochondrion 12S Jemu AAACTAGGATTAGATACCC Termites DAG
28SfGink Forward Nucleus 28S Jemu GACCAAGGAGTCTAACATGTGC Termites DAG
28SfHux Forward Nucleus 28S Jemu ACACGGACCAAGGAGTCTAAC Termites DAG
28SfMB2 Forward Nucleus 28S Jemu TCTAACATGTGCGCGAGTC Termites DAG
28SrGPW2 Reverse Nucleus 28S Jemu GCAACCAACGCCTTTCA Termites DAG
28SrGPW3 Reverse Nucleus 28S Jemu TTAACCCGGCGTTTGGTTC Termites DAG
28SrWin Reverse Nucleus 28S Jemu GTCCTGCTGTCTTAAGCAACC Termites DAG
COIcalvin NA Mitochondrion COI Jemu GGRAARAAWGTTAARTTWACTCC Termites DAG
COIF Forward Mitochondrion COI Jemu GAACAGAACTTGGACAACA Termites DAG
12Sf Forward Mitochondrion 12S Jemu TACTATGTTACGACTTAT Termites DAG
CO1aaF Forward Mitochondrion COI Malacology ATTCGGCCATTCTACCTGTG Lizard NA
CO1aaR Reverse Mitochondrion COI Malacology GCTAAYGGTGGGTAAACAGT Lizard NA
COIIA-tLeumod Forward Mitochondrion COII Jemu CAGATAAGTGCATTGGATTT Termites DAG
COIIB-tLys Reverse Mitochondrion COII Jemu GTTTAAGAGACCAGTACTTG Termites DAG
CRaF Forward Mitochondrion Control_region Malacology CATCAATCACTACCCTCCATAATC Lizard NA
CRaR_ Reverse Mitochondrion Control_region Malacology GTAGGAGCACTTGAGATGAGGTC Lizard NA
CRbF Forward Mitochondrion Control_region Malacology TTACCCTCTTACCCTTGCTC Lizard NA
CRbR Reverse Mitochondrion Control_region Malacology TTTAGTTTCGTGTGATGAGCA Lizard NA
NT3-R4 Reverse NA NA Jemu GCGTTTCATAAAAATATTGTTTGACC NA NA
cytb-L14723 Forward Mitochondrion Cytb Jemu ACCAATGACATGAAAAATCATCGTT NA NA
LEU-1 NA NA NA Jemu CATTACTTTTACTTGGATTTGCACCA NA NA
ND4-1 NA NA NA Jemu CACCTATGACTACCAAAAGCTCATGTAGAAGC NA NA
NT3-F3 Forward NA NA Jemu ATATTTCTGGCTTTTCTCTGTGGC NA NA
Pan_270-291 NA Mitochondrion COI Jemu tatacgggggaatgccatgtcg Panidae BarPan
Pan_H172-193 Reverse Mitochondrion COI Jemu ttacgaacgcatgggctgtgac Panidae BarPan
Pan_L1-26 Forward Mitochondrion COI Jemu atgttcaccgaccgctgacta Panidae BarPan
Pan_L5-21 Forward Mitochondrion COI Jemu TCACCGACCGCTGACTATTCTC Panidae BarPan
CF1 Forward Nucleus RAG1_exon3 Vertebrates GCCGCCAGATCTTCCAGCCCT Fishes NA
CR5 Reverse Nucleus RAG1_exon3 Vertebrates TGCGGGCGTAGTTTCCATTCA Fishes NA
H_CYTB Reverse Mitochondrion Cytochrome_b Vertebrates CAGGTGAGGATGGCGACG Fishes NA
L_ATP Forward NA ATP_synthase_6+8 Vertebrates TAGCGTTAGCCTTTTAAGCT Fishes NA
L_CYTB Forward Mitochondrion Cytochrome_b Vertebrates ACTAATGACTTGAAAAACCACC Fishes NA
LPRO2 Forward Mitochondrion Control_region Vertebrates CTCTCACCCCTAGCTCCCAAAG Fishes NA
R_ATP Reverse NA ATP_synthase_6+8 Vertebrates TATGCRTGTGCTTGMTGGGC Fishes NA
TDK-DH4-SHORT NA Mitochondrion Control_region Vertebrates GATCCCATCTTCAGTGTTATGC Fishes NA
CR1 Reverse Nucleus RAG1_intron2 Vertebrates AGGGCTGGAATATCTGGCGG Fishes NA
ITS_18D NA Nucleus ITS Vertebrates TACACACCGCCCGTCGCTACTACCG Fishes NA
ITS_28C NA Nucleus ITS Vertebrates CTTAAATTCAGCGGGTTGTCTCGTCTG Fishes NA
ITS_58C NA Nucleus ITS Vertebrates GTGCGTTCGAAGTGTCGATGATCAA Fishes NA
KALIF1 Forward Nucleus RAG1_intron2 Vertebrates AAGGGTTTATGTTCAATCAA Fishes NA
LSU_F1 Forward Nucleus LSU Vertebrates AGCGGAGGAAAAGAAACTA Fishes NA
LSU_R1 Reverse Nucleus LSU Vertebrates TACTAGAAGGTTCGATTAGTC Fishes NA
Gor_H333_354 Reverse Mitochondrion COI Jemu TACTATAGCGGATGCGAGCAGA Gorillas BarPan
Hom_H151_173 Reverse Mitochondrion COI Jemu ACAATGACATTATAGATGTGGTC Hominids BarPan
Hom_H349_368 Reverse Mitochondrion COI Jemu CCGGCGCCGGCTTCTACTAT Hominids BarPan
Hom_H706_731 Reverse Mitochondrion COI Jemu TAAACTTCGGGGTGGCCAAAAAATCA Hominids BarPan
RepCOI-F Forward Mitochondrion COI Jemu TNTTMTCAACNAACCACAAAGA Reptiles BARMAR
uPhe-1H Reverse NA NA NA GCATCTTCAGTGCYATGCTT NA NA
uThr-1L Forward NA NA NA AAAGCATTGGTCTTGTAARCC NA NA
Aves_H534_556d Reverse Mitochondrion COI Jemu ACGAATAGGGGGGTTTGRTAYTG birds BarCoVer
Aves_L288_310d Forward Mitochondrion COI Jemu CGCATAAAYAACATAAGCTTYTG birds BarCoVer
Aves_L501_523d Forward Mitochondrion COI Jemu ACCGCCATCAACATAAAACCNCC birds BarCoVer
birdR1d Reverse Mitochondrion COI Jemu ACGTGGGAGATGATTCCGAAKCCKGG birds BarCoVer
Hom_L25_50 Forward Mitochondrion COI Jemu TCTACAAACCACAAAGATATTGGAAC Hominids BarPan
Pan_H165_187 Reverse Mitochondrion COI Jemu ACGCATGGGCTGTGACAATGACA Pan_paniscus BarPan
Pan_H333_354 Reverse Mitochondrion COI Jemu TACTATGGCAGATGCAAGTAGA Pan_paniscus BarPan
Pan_H336_357 Reverse Mitochondrion COI Jemu TTCTACTATGGCAGATGCAAGT Pan_paniscus BarPan
Aves_H534_556 Reverse Mitochondrion COI Jemu ACGAATAGGGGGGTTTGGTATTG birds BarCoVer
Aves_L288_310 Forward Mitochondrion COI Jemu CGCATAAACAACATAAGCTTCTG birds BarCoVer
Aves_L501_523 Forward Mitochondrion COI Jemu ACCGCCATCAACATAAAACCCCC birds BarCoVer
IcCytb-F1_ Forward Mitochondrion cytb Synodontis TTTYTACAYGAAACVGGCTCCAA Synodontis NA
IcCytb-R1_ Reverse Mitochondrion cytb Synodontis TTGGAGCCBGTTTCRTGTARAAA Synodontis NA
ICytb-R1_ Reverse Mitochondrion Cytb Synodontis CTGGGGTGAAGTTTTCTGGG Synodontis NA
Thr-R1_ Reverse NA Thr Synodontis TTTAGAATTCTGGCTTTGGGAG Synodontis NA
Glu-2_ NA NA Glu Synodontis AACCACCGTTGTTATTCAACTA Synodontis NA
Glyt_F559 Forward NA Glyt Vertebrates GGACTGTCMAAGATGACCACMT Fishes NA
Glyt_F577 Forward NA Glyt Vertebrates ACATGGTACCAGTATGGCTTTGT Fishes NA
Glyt_R1464 Reverse NA Glyt Vertebrates GTAAGGCATATASGTGTTCTCTCC Fishes NA
Glyt_R1562 Reverse NA Glyt Vertebrates CCCAAGAGGTTCTTGTTRAAGAT Fishes NA
ICytb-F1_ Forward Mitochondrion Cytb Synodontis TTCCTTYCACCCCTATTTCT Synodontis NA
Pro-R1_ Reverse NA Pro Synodontis TAGTTTAGTTTAGAATTCTGGCTTTGG Synodontis NA
Psic16Sf Forward Mitochondrion 16S Robin_Rotsaert TAACCGTGCAAAGGTAGCATAA reptiles Podarcis
Psic16Sr Reverse Mitochondrion 16S Robin_Rotsaert ATCCAACATCGAGGTCGTAAAC reptiles Podarcis
PsiCo1bR6007 Reverse Mitochondrion COI Robin_Rotsaert GTGACCAAAGAATCAGAAYAGGTGT reptiles Podarcis
Psico1dF Forward Mitochondrion COI Robin_Rotsaert GCGCTCCTGACATAGCATT reptiles Podarcis
Psico1dR Reverse Mitochondrion COI Robin_Rotsaert TCTGGGTGACCAAAGAATCA reptiles Podarcis
RYR3_F15 Forward NA RYR Vertebrates GGAACTATYGGTAAGCARATGG Fishes NA
RYR3_F22 Forward NA RYR Vertebrates TCGGTAAGCARATGGTGGACA Fishes NA
RYR3_R931 Reverse NA RYR Vertebrates AGAATCCRGTGAAGAGCATCCA Fishes NA
RYR3_R968 Reverse NA RYR Vertebrates TGGAAGAAKCCAAAKATGATGC Fishes NA
28SC NA Nucleus 28S EVA GGTTCGATTAGTCTTTCGCC NA Oonopidae
28SO NA Nucleus 28S EVA GAAACTGCTCAAAGGTAAACGG NA Oonopidae
28SZX1 NA Nucleus 28S EVA ACCCGCTGAATTTAAGCATAT NA Oonopidae
H3AR Reverse NA H3 EVA ATATCCTTRGGCATRATRGTGAC NA Oonopidae
LR-N-13398 NA NA 16S/ND1 EVA CGCCTGTTTAACAAAAACAT NA Oonopidae
N1-J-12261 NA NA 16S/ND1 EVA TCRTAAGAAATTATTTGAGC NA Oonopidae
PsiCo1aF5266 Forward Mitochondrion COI Robin_Rotsaert TATTACTCAGCCATCCTACCTGTGT reptiles Podarcis
PsiCo1aR5753 Reverse Mitochondrion COI Robin_Rotsaert GARACTCCTGCTARATGAAGTGAAA reptiles Podarcis
PsiCo1bF5554 Forward Mitochondrion COI Robin_Rotsaert CCTGACATAGCATTTCCACGAATA reptiles Podarcis
12SAI NA Mitochondrion 12S EVA AAACTAGGATTAGATACCCTATTAT NA Oonopidae
12SBI NA Mitochondrion 12S EVA AAGAGCGACGGGCGATGTGT NA Oonopidae
Actin-F-254 Forward Nucleus Actin EVA ACNAACTGGGATGATATGGAGAA NA Oonopidae
Actin-R-1009 Reverse Nucleus Actin EVA CCNCCRATCCANACGGARTACTT NA Oonopidae
Actin5C-F-229 Forward Nucleus Actin EVA AAGTATCCNATTGAGCATGGTATTG NA Oonopidae
Actin5C-R-1057 Reverse Nucleus Actin EVA TTNGADATCCACATTTGTTGGAA NA Oonopidae
COI-2183R2 Reverse Mitochondrion COI EVA CCAAAAAATCAAAATARATGYTG NA Oonopidae
H3AF Forward NA H3 EVA ATGGCTCGTACCAAGCAGACVGC NA Oonopidae
ND1-R-TL1/N12718 NA NA ND1 EVA TGCATTAGAATTAGAATCTA NA Oonopidae
12SF Forward Mitochondrion 12S EVA AAGAGCGACGGGCGATGTGT NA NA
12SR Reverse Mitochondrion 12S EVA CTAGGATTAGATACCCTATTAT NA NA
CO2183R2 Reverse Mitochondrion COI EVA CCAAAAAATCAAAATARATGYTG NA NA
COI_ Forward Mitochondrion COI EVA GGTCAACAAATCATAAAGATATTGG NA Oonopidae
COIF Forward Mitochondrion COI EVA GGGGGGTTTGGAAATTGATTAGTTCC NA NA
COIR Reverse Mitochondrion COI EVA CCCGGTAAAATTAAAATATAAACTTC NA NA
28SRD7B1 NA Nucleus 28S EVA GACTTCCCTTACCTACAT NA Oonopidae
CO1490F Forward Mitochondrion COI EVA GGTCAACAAATCATAAAGATATTGG NA NA
HCOEXTERNA NA Mitochondrion COI EVA GAAGTTTATATTTTAATTTTACCTGG NA Oonopidae
HCOEXTERNB NA Mitochondrion COI EVA CCTATTGAWARAACATARTGAAAATG NA Oonopidae
HCOOUTOUT Reverse Mitochondrion COI EVA GTAAATATATGRTGDGCTC NA Oonopidae
LCO Forward Mitochondrion COI EVA GGTCAACAAATCATAAAGATATTGG NA Oonopidae
28S32A NA Nucleus 28S EVA AGTACGTGAAACCGTTCASGGGT NA Oonopidae
28SA NA Nucleus 28S EVA GACCCGTCTTGAAGCACG NA Oonopidae
28SB NA Nucleus 28S EVA TCGGAAGGAACCAGCTACTA NA Oonopidae
28SBOUT NA Nucleus 28S EVA CCCACAGCGCCAGTTCTGCTTACC NA Oonopidae
28SRD48A NA Nucleus 28S EVA ACCTATTCTCAAACTTTAAATGG NA Oonopidae
18S3F Forward Nucleus 18S EVA GTTCGATTCCGGAGAGGGA NA Oonopidae
18S5R Reverse Nucleus 18S EVA CTTGGCAAATGCTTTCGC NA Oonopidae
18S9R Reverse Nucleus 18S EVA GATCCTTCCGCAGGTTCACCTAC NA Oonopidae
18SA20 NA Nucleus 18S EVA ATGGTTGCAAAGCTGAAAC NA Oonopidae
18SBI NA Nucleus 18S EVA GAGTCTCGTTCGTTATCGGA NA Oonopidae
28SRD1A NA Nucleus 28S EVA CCCSCGTAAYTTAGGCATAT NA Oonopidae
28SRD4B Reverse Nucleus 28S EVA CCTTGGTCCGTGTTTCAAGAC NA Oonopidae
16SA Forward Mitochondrion 16S EVA CGCCTGTTTATCAAAAACAT NA Oonopidae
16SB Reverse Mitochondrion 16S EVA CTCCGGTTTGAACTCAGATCA NA Oonopidae
16SF Forward Mitochondrion 16S EVA TTGGCCTGTTTATCAAAAACATG NA NA
16SR Reverse Mitochondrion 16S EVA CTTACGCCGGTCTGAACTCAG NA NA
18S1F Forward Nucleus 18S EVA TACCTGGTTGATCCTGCCAGTAG NA Oonopidae
SRY3F2 Forward Nucleus SRY JEMU CTGCTTGAGTTCAAAGATCATC Mammals BarCoVer_Mammals
SRY3R2_ Reverse Nucleus SRY JEMU AGGGAGCTTTCCATCCAAGTAC Mammals BarCoVer_Mammals
PRLR_f1 Forward Nucleus PRLR JEMU GACARYGARGACCAGCAACTRATGCC Mammals BarCoVer_Mammals
PRLR_f1mam Forward Nucleus PRLR JEMU GACARYGAGGACCAGCAKCTRATGCC Mammals BarCoVer_Mammals
PRLR_r3 Reverse Nucleus PRLR JEMU GACYTTGTGRACTTCYACRTAATCCAT Mammals BarCoVer_Mammals
PRLR_r3mam Reverse Nucleus PRLR JEMU GACYTTGTGAATCTCCACRTAATC Mammals BarCoVer_Mammals
SRY3F1____ Forward Nucleus SRY JEMU CATGTAAAGAATTCAGACTTTCC Mammals BarCoVer_Mammals
SRY3R1____ Reverse Nucleus SRY JEMU CCATCTAACTAATGACCAATCTC Mammals BarCoVer_Mammals
SRY5F__40_________ Forward Nucleus SRY JEMU CCTGTTAAGTAGCTTTGCTTGAG Mammals BarCoVer_Mammals
SRY5R_______ Reverse Nucleus SRY JEMU CACAGCTGGACTGTAAACATCGT Mammals BarCoVer_Mammals
UBN1_r2mam Reverse Nucleus UBN JEMU GGTCAGYAAYTTKGCCACHCCCT Mammals BarCoVer_Mammals
PTPN12_f1 Forward Nucleus PTPN JEMU AGTTGCCTTGTWGAAGGRGATGC Mammals BarCoVer_Mammals
PTPN12_f1mam Forward Nucleus PTPN JEMU AGTTGCCTTGTAGAAGGGGATGC Mammals BarCoVer_Mammals
PTPN12_r6 Reverse Nucleus PTPN JEMU CTRGCAATKGACATYGGYAATAC Mammals BarCoVer_Mammals
PTPN12_r6mam Reverse Nucleus PTPN JEMU CTRGCAATGGACATYGGYAATAC Mammals BarCoVer_Mammals
SPTBN1B Reverse Nucleus SPTBN JEMU CTGCCATCTCCCAGAAGAA Mammals BarCoVer_Mammals
SPTBN1C Forward Nucleus SPTBN JEMU GAAGACCTGTTACAGAAGCA Mammals BarCoVer_Mammals
SPTBN1D Reverse Nucleus SPTBN JEMU TCTGCTGCCAACTGGCAAAGC Mammals BarCoVer_Mammals
UBN1_f1 Forward Nucleus UBN JEMU CCYCTMAATTTYCTGGCWGARCAGGC Mammals BarCoVer_Mammals
UBN1_f1mam Forward Nucleus UBN JEMU CCYCTCAATTTTCTGGCWGARCAGGCT Mammals BarCoVer_Mammals
UBN1_r2 Reverse Nucleus UBN JEMU GGTCAGYAAYTTKGCCACHCCYT Mammals BarCoVer_Mammals
28F Forward Nucleus 28S_rDNA JEMU TTAGTAGGGGCGACCGAACAGGGAT Amphipods BARCOLYS
28R Reverse Nucleus 28S_rDNA JEMU GTCTTTCGCCCCTATGCCCAACTGA Amphipods BARCOLYS
28S-3311F Forward Nucleus 28S_rDNA JEMU GGGACTACCCCCTGAATTTAAGCAT Amphipods BARCOLYS
28S-4434R Reverse Nucleus 28S_rDNA JEMU CCAGCTATCCTGAGGGAAACTTCG Amphipods BARCOLYS
28Sa Forward Nucleus 28S_rDNA JEMU TTGGCGACCCGCAATTTAAGCAT Amphipods BARCOLYS
28Sb Reverse Nucleus 28S_rDNA JEMU CCTGAGGGAAACTTCGGAGGGAAC Amphipods BARCOLYS
FishR2 Reverse Mitochondrion COI JEMU ACTTCAGGGTGACCGAAGAATCAGAA Fish BarCoVer
SPTBN1A Forward Nucleus SPTBN JEMU TCTCAAGACTATGGCAAACA Mammals BarCoVer_Mammals
VF2 Forward Mitochondrion COI JEMU CAACCAACCACAAAGACATTGGCAC Fish BarCoVer
28S_D2F Forward Nucleus 28S_rDNA JEMU CGTGTTGCTTGATAGTGCAGC sawflies ECES_PSEU
28S_D2R Reverse Nucleus 28S_rDNA JEMU TTGGTCCGTGTTTCAAGACGG sawflies ECES_PSEU
Cytb238 NA Mitochondrion Cytb JEMU CGACAACTACACTTAAACGGAGCA elephant_ID BarCoVer
Cytb389 NA Mitochondrion Cytb JEMU CCTATGAAGGCGGTGGTTATG elephant_ID BarCoVer
LPro2:_ NA Mitochondrion Dloop JEMU CTCTCACCCCTAGCTCCCAAAG NA NA
TDK-DH4short:_ NA Mitochondrion Dloop JEMU GATCCCATCTTCAGTGTTATGC NA NA
A2590 Reverse Mitochondrion COI JEMU GCTCCTATTGATARWACATARTGRAAATG sawfly ECES_PSEU
CB-J-10933 Forward Mitochondrion Cytb JEMU TATGTACTACCATGAGGACAAATATC sawflies ECES_PSEU
CB-N-11367 Reverse Mitochondrion Cytb JEMU ATTACACCTCCTAATTTATTAGGAAT sawflies ECES_PSEU
FishR2_t1 Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACACTTCAGGGTGACCGAAGAATCAGAA fish_mammal_cocktail BarCoVer
FR1d_t1 Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACACCTCAGGGTGTCCGAARAAYCARAA fish_mammal_cocktail BarCoVer
M13F Forward NA tail for seq (no marker) JEMU TGTAAAACGACGGCCAGT for PCR cocktail BarCoVer
M13R Reverse NA tail for seq (no marker) JEMU CAGGAAACAGCTATGAC for PCR cocktail BarCoVer
sym-C1-J-1718_ Forward Mitochondrion COI JEMU GGAGGATTTGGAAAYTGAYTAGTWCC sawfly ECES_PSEU
FishF2_t1 Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTCGACTAATCATAAAGATATCGGCAC fish_mammal_cocktail BarCoVer
LepF1_t1 Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG Mammal_rept_fish_amph_cocktail BarCoVer
LepR1_t1 Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAAATCA Mammal_rept_fish_amph_cocktail BarCoVer
VF1_t1 Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTTCTCAACCAACCACAAAGACATTGG Mammal_rept_fish_amph_cocktail BarCoVer
VF1d_t1 Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTTCTCAACCAACCACAARGAYATYGG Mammal_rept_fish_amph_cocktail BarCoVer
VF2_t1_ Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTCAACCAACCACAAAGACATTGGCAC fish_mammal_cocktail BarCoVer
VR1_t1_ Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCAAAGAATCA Mammal_rept_fish_amph_cocktail BarCoVer
VR1d_t1 Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA Mammal_rept_fish_amph_cocktail BarCoVer
Bird_H153_175d Reverse Mitochondrion COI JEMU ACGATTACRTTGTARATYTGRTC Birds BarCoVer
Bird_H153_175dt Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACACGATTACRTTGTARATYTGRTC Birds BarCoVer
BirdF1dt Forward Mitochondrion COI JEMU TGTAAAACGACGGCCAGTTCAACCAACCACAAAGAYATYGGYAC Birds BarCoVer
FF2d_1_ Forward Mitochondrion COI JEMU TTCTCCACCAACCACAARGAYATYGG fishes BarCoVer
FR1d_1_ Reverse Mitochondrion COI JEMU CACCTCAGGGTGTCCGAARAAYCARAA fishes BarCoVer
LEP-F1 Forward Mitochondrion COI JEMU ATTCAACCAATCATAAAGATAT lepidoptera_fishes_etc BarCoVer
LEP-R1 Reverse Mitochondrion COI JEMU TAAACTTCTGGATGTCCAAAAA lepidoptera_fishes_etc BarCoVer
LEP-R2 Reverse Mitochondrion COI JEMU CTTATATTATTTATTCGTGGGAAAGC lepidoptera_fishes_etc BarCoVer
Bird_H351_370d Reverse Mitochondrion COI JEMU CCTGCTCCWGCTTCTAYDGT Birds BarCoVer
Bird_H351_370dt Reverse Mitochondrion COI JEMU CAGGAAACAGCTATGACCCTGCTCCWGCTTCTAYDGT Birds BarCoVer
BirdF1 Forward Mitochondrion COI JEMU TTCTCCAACCACAAAGACATTGGCAC birds BarCoVer
BirdF1d Forward Mitochondrion COI JEMU TCAACCAACCACAAAGAYATYGGYAC Birds BarCoVer
BirdR1 Reverse Mitochondrion COI JEMU ACGTGGGAGATAATTCCAAATCCTGG birds BarCoVer
HCO2198 Reverse Mitochondrion COI JEMU TAAACTTCAGGGTGACCAAAAAATCA universal BarCoVer
LCO1490 Forward Mitochondrion COI JEMU GGTCAACAAATCATAAAGATATTGG universal BarCoVer
RepCOI-R Reverse Mitochondrion COI Jemu ACTTCTGGRTGKCCAAARAATCA Reptiles BARMAR
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith