Error message

Notice: Undefined property: stdClass::$comment_count in comment_node_page_additions() (line 728 of /var/aegir/platforms/scratchpads-2.9.4/modules/comment/comment.module).

C1J-1751

Reference: 
Bond_2004
Marker name: 
COI
Direction: 
Forward
Genome: 
Mitochondrion
Specificity: 
none
project name: 
NA
Owner: 
Frederik_Hendrickx
Position on sequence: 
C1N-2776
Comment: 
mitochondrial
Sequence: 
GAGCTCCTGATATAGCTTTTCC

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith