CF1

Reference: 
Clabaut_C_Salzburger_W_&_Meyer_A_(2005)_Comparative_phylogenetic_analyses_of_the_adaptive_radiation_of_lake_tanganyika_cichlid_fish:_Nuclear_sequences_are_less_homoplasious_but_also_less_informative_than_mitochondrial_DNA_J_Mol_Evol_61(5)_666-81]
Marker name: 
RAG1_exon3
Direction: 
Forward
Genome: 
Nucleus
Specificity: 
Fishes
project name: 
NA
Owner: 
Vertebrates
Position on sequence: 
NA
Comment: 
NA
Sequence: 
GCCGCCAGATCTTCCAGCCCT

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith