COIIB-tLys

Reference: 
Beckenbach_et_al_(1993)
Marker name: 
COII
Direction: 
Reverse
Genome: 
Mitochondrion
Specificity: 
Termites
project name: 
DAG
Owner: 
Jemu
Position on sequence: 
NA
Comment: 
NA
Sequence: 
GTTTAAGAGACCAGTACTTG

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith