L14723_Cytb

Reference: 
Ducroz JF, Volobouev V, Granjon L (2001) An Assessment of the Systematics of Arvicanthine Rodents Using Mitochondrial DNA Sequences: Evolutionary and Biogeographical Implications. J Mamm Evol 8:173–206
Marker name: 
cob_cytb
Direction: 
Forward
Genome: 
Mitochondrion
Specificity: 
Vertebrates
project name: 
DEMOTRORO
Owner: 
JEMU
Position on sequence: 
NA
Comment: 
NA
Sequence: 
ACCAATGACATGAAAAATCATCGTT

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith