DL7F

Reference: 
Palomares et al. 2002 Molecular Ecology 11, 2171–2182
Marker name: 
D-loop
Direction: 
Forward
Genome: 
Mitochondrion
Specificity: 
Lynx
project name: 
DNA-ID
Owner: 
JEMU_RBINS
Sequence: 
CTTAATCGTGCATTATACCTTGT

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith