Darw1-F

Reference: 
karin et al in press
Marker name: 
COI
Direction: 
Forward
Genome: 
Mitochondrion
Specificity: 
Darwinitium Ganesella
Owner: 
Karin Breugelmans
Position on sequence: 
114-133 compared to fragment obtained with LCO
Comment: 
usage description in doc file "primers Darwinitium.docx"
Sequence: 
ATGTTGTAGTGACTGCTCAT
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith