Pro-R1_

Reference: 
NA
Marker name: 
Pro
Direction: 
Reverse
Genome: 
NA
Specificity: 
Synodontis
project name: 
NA
Owner: 
Synodontis
Position on sequence: 
NA
Comment: 
NA
Sequence: 
TAGTTTAGTTTAGAATTCTGGCTTTGG

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith