Error message

Notice: Undefined property: stdClass::$comment_count in comment_node_page_additions() (line 728 of /var/aegir/platforms/scratchpads-2.9.4/modules/comment/comment.module).

PsiCo1bF5554

Reference: 
NA
Marker name: 
COI
Direction: 
Forward
Genome: 
Mitochondrion
Specificity: 
reptiles
project name: 
Podarcis
Owner: 
Robin_Rotsaert
Position on sequence: 
NA
Comment: 
PsiCo1aF5266-->PsiCo1bR6007_covers_most_of_LCO1490-->HCO2200
Sequence: 
CCTGACATAGCATTTCCACGAATA

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith