SRY3R1____

Reference: 
Hassanin_&_Ropiquet_2010
Marker name: 
SRY
Direction: 
Reverse
Genome: 
Nucleus
Specificity: 
Mammals
project name: 
BarCoVer_Mammals
Owner: 
JEMU
Position on sequence: 
NA
Comment: 
NA
Sequence: 
CCATCTAACTAATGACCAATCTC

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith