TL1-N-12718

Reference: 
Hedin_1997
Marker name: 
NADH_1
Direction: 
Reverse
Genome: 
NA
Specificity: 
none
project name: 
NA
Owner: 
Frederik_Hendrickx
Position on sequence: 
N1-J-12261
Comment: 
mitochondrial
Sequence: 
TGCATTAGAATTAGAATCTA

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith