Wsp691R-spider

Reference: 
Goodacre_et_al_2006
Marker name: 
Wolbachia_WSP
Direction: 
Reverse
Genome: 
NA
Specificity: 
NA
project name: 
NA
Owner: 
Frederik_Hendrickx
Position on sequence: 
NA
Comment: 
bacterial
Sequence: 
AAAAATTAAACGCTACTCCAGCTTCTGCAC

Add new comment

You must have Javascript enabled to use this form.
Scratchpads developed and conceived by (alphabetical): Ed Baker, Katherine Bouton Alice Heaton Dimitris Koureas, Laurence Livermore, Dave Roberts, Simon Rycroft, Ben Scott, Vince Smith